Ma `lumot

Yuqori oqimdagi ochiq o'qish ramkasi orqali tarjima repressiyasi nimani anglatadi?

Yuqori oqimdagi ochiq o'qish ramkasi orqali tarjima repressiyasi nimani anglatadi?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

NCBIning inson ovchi geni haqidagi hisobotida quyidagi bayonot mavjud:

"Bu gen 5 -UTR -da yuqori o'qiladigan ochiq o'qish ramkasini o'z ichiga oladi, u tarjimali repressiya orqali ovchilik gen mahsulotining ifoda etilishiga to'sqinlik qiladi."

Ammo aniq ma'lumot yo'q. Kimdir bu nimani anglatishini tushuntira oladimi?


Xulosa

Bayonot, mRNK (3144 aminokislotalar) ning mRNK (va gen) funktsional mahsulotini kodlaydigan asosiy ochiq o'qish ramkasiga 5 'ovchining mRNK qisqa ochiq o'qish ramkalari (ORF) ning kichik, ammo muhim tarjimasiga tegishli. Ma'lum bo'lishicha, bu qisqa ORFlarning tarjimasi asosiy ORFdan tarjimani kamaytiradi (ya'ni inhibe qiladi). Shuni nazarda tutish kerakki, bu gen ifodasini tartibga solish mexanizmi va u sitoplazmadagi mRNKda bo'lgani kabi, "tarjima regulyatsiyasi" ning, xususan, inhibisyonning namunasidir. Ushbu tartibga solishning aniq mexanizmi, garchi bu mRNKga xos bo'lmasa -da, noma'lum.

Eukaryotik mRNKda ORFlarning tarjimasi

Ko'pgina eukaryotik mRNKlar funktsional monokistronikdir, ya'ni bakterial mRNKlardan farqli o'laroq, ular faqat bitta oqsilni kodlaydi. Protein sintezining boshlanishi tashabbus kodini (odatda AUG) tashabbuskor-tRNK va kichik ribosoma bo'linmasi bilan tanlashni o'z ichiga oladi, lekin prokaryotlardan farqli o'laroq, eukaryotlarning mexanizmi mRNK bo'ylab 5 'uchidan skanerlashni o'z ichiga oladi. Aksariyat hollarda oqsil mahsulotining boshlang'ich kodoni birinchi AUG hisoblanadi, lekin ko'p sonli istisnolar ketma -ket kontekst yoki mRNK ikkilamchi tuzilishining ta'sirini ko'rsatadi.

So'nggi yillarda, birinchi AUG asosiy oqsil mahsuloti bo'lmagan hollarda, bunday 5 'yuqori oqimdagi ORFlardan oz miqdordagi tarjima tez -tez uchrab turishi haqida dalillar to'plandi.

mRNK ning yuqori oqimdagi ORF (ko‘k, ochiq uchburchak sifatida ko‘rsatilgan boshlang‘ich kodonli) va asosiy ORF (yopiq uchburchak sifatida boshlash kodonli qora) bilan diagrammatik tasviri.

Yuqori oqim ORFlarining tartibga soluvchi roli

Jonstone va boshqalar. (2016) yuqori oqimdagi ORFlar eukaryotlarda translyatsion repressorlar ekanligini ko'rsatadigan ko'plab dalillarni ko'rib chiqdi. Bu, odatda, yuqori oqimdagi ORFlarni manipulyatsiya qilish yoki olib tashlashdan keyin asosiy ORFning tarjima darajasini o'lchash yo'li bilan aniqlanadi. Bunday tartibga solishning haqiqiy mexanizmi haqida ko'p narsa ma'lum emas, bu har bir holatda farq qilishi mumkin va, albatta, ovchilik haqidagi maqolada faqat spekulyativ imkoniyatlar mavjud. Bularga quyidagilar kiradi:

  • Kichik peptidli mahsulotlarning yuqori oqimdagi ORFlarning asosiy ORF AUG bilan bog'lanishi
  • Ribosomal boshlang'ich majmuasini to'xtatib turish, boshqa ORFning AUGga o'tishiga to'sqinlik qiladigan yuqori oqimdagi ORFlarda.
  • Ribosomal boshlash kompleksini yuqori oqimdagi ORFlarda bog'lash orqali mRNKning ikkilamchi tuzilishining o'zgarishi 5' uchi "erigan" boshlash bosqichining qiyinligini oshiradi.

Ko'rinib turibdiki, yuqoridagi ORFlarni tarjima qilish darajasi va shuning uchun repressiya darajasi eIF2 boshlash omilining fosforillanishi kabi mexanizmlar bilan tartibga solinishi mumkin.


Yuqori oqimdagi ochiq o'qish ramkasi orqali tarjima repressiyasi nimani anglatadi? - Biologiya

Tartibni tartibga solish tahlili msl-2 mRNA jinsiy o'lim (SXL), bu dozani qoplash uchun juda muhimdir Drosophila, 5-sonli tarjima qilinmagan umumiy mintaqaviy elementlarga, yuqori oqimdagi ochiq o'qish ramkalariga (RNK) va RNK bilan bog'laydigan oqsillar uchun o'zaro ta'sir joylariga asoslangan translyatsion nazorat usulini ochdi. Biz shuni ko'rsatadiki, SXL qisqa uORF oqimining pastki oqimiga ulanishi katta o'qish ramkalari tarjimasiga kuchli salbiy ta'sir ko'rsatadi. Asosiy mexanizm uORFda ribosomalarni skanerlashni boshlanishini va uning quyi oqimdagi tarjimasiga to'sqinlik qilishni kuchaytirishni o'z ichiga oladi. Bizning tahlillarimiz shuni ko'rsatadiki, SXL o'z ta'sirini uORFda cho'zish yoki tugatishni emas, balki nazorat qilishni boshlaydi. Asosiy mexanizmning umumiyligini tekshirib, biz eksperimental tarzda belgilaydigan tartibga solish moduli heterologik kontekstda ishlashini ko'rsatamiz va biz tabiiyni aniqlaymiz. Drosophila mRNAlar ushbu modul orqali tartibga solinadi. Biz oqsil bilan tartibga solinadigan uORFlar oqsil sintezini tartibga solishning tizimli printsipi bo'lishini taklif qilamiz.

Grafik abstrakt

Asosiy voqealar

Drosophila SXL oqsili tartibga solish uchun uORF bilan hamkorlik qiladi msl-2 mRNK tarjimasi ► SXL vositachiligidagi tartibga solish cho‘zilish yoki tugatish emas, tarjima boshlanishini maqsad qiladi ► SXL uORFni ribosoma tanib olishiga yordam beradi va shu bilan inhibe qiladi. msl-2 tarjima ► Protein bilan boshqariladigan uORFlar tarjimani boshqarishning umumiy mexanizmini belgilashi mumkin


Yuqoridagi ochiq o'qish doirasi orqali tarjima repressiyasi nimani anglatadi? - Biologiya

S-Adenosilmetionin dekarboksilaza (AdoMetDC) poliamin biosintezidagi asosiy ferment hisoblanadi. Biz shuni ko'rsatamizki, o'simlikning AdoMetDC faoliyati poliaminlar tomonidan transkripsiyadan keyingi nazorat ostida bo'ladi. AdoMetDC mRNA 5 "etakchisida yuqori darajada saqlanib qolgan kichik o'qiladigan ochiq o'qish ramkasi (uORF) transgenli tamaki o'simliklarida b-glyukuronidazning quyi oqimidagi muxbiri tsistronning translyatsion repressiyasi uchun javobgardir. AdoMetDC cDNA -dan kichik uORFni yo'q qilish transgen o'simliklardagi AdoMetDC proenzimining nisbiy tarjima samaradorligini oshirishga olib keldi. Natijada AdoMetDC faolligining oshishi poliamin darajasining buzilishiga olib keldi, bu putresinning kamayishi, spermin darajasining pasayishi va dekarboksillangan moddalar darajasining 400 baravar oshishiga olib keldi. S-adenosilmetionin. Bu o'zgarishlar jiddiy o'sish va rivojlanish nuqsonlari bilan bog'liq edi. Dekarboksillanishning yuqori darajasi S-adenosilmetionin genomik DNK va 5'-metilsitozin tarkibidagi o'zgarishlar bilan bog'liq emas edi. S-adenosilmetionin darajasi ko'p yoki kamroq normal edi, bu texnik xizmat ko'rsatishning yuqori samarali tizimini ko'rsatadiS-o'simliklardagi adenosilmetionin miqdori. Bu ish shuni ko'rsatadiki, uORF vositachiligida AdoMetDC-ni tarjima nazorati poliamin gomeostaz uchun va normal o'sish va rivojlanish uchun zarurdir.


Yuqoridagi ochiq o'qish doirasi orqali tarjima repressiyasi nimani anglatadi? - Biologiya

HER-2 ning haddan tashqari ifodalanishi (neu, erb B-2) retseptorlari hujayrali transformatsiyaga olib keladi va odamlarning turli xil saraton kasalliklari bilan bog'liq. Ko'p sonli mexanizmlar, shu jumladan genlarni ko'paytirish va transkripsiya, post-transkripsiya va translyatsion boshqaruv HER-2 ifodasini tartibga solishga yordam beradi. Ushbu tartibga soluvchi mexanizmlarning tarkibiy qismlaridan biri bu HER-2 mRNKdagi yuqori oqimdagi qisqa o'qish doirasi (uORF) bo'lib, u turli hujayralardagi quyi oqimdagi tarjimani bostiradi. Bu erda biz bu uORF inhibitiv ta'sir ko'rsatadigan mexanizmni o'rganamiz.

Protein va mRNK ko'pligini taqqoslash va polisomal tarqalish tahlillariga ko'ra, uORF HER-2 tsistroni yoki heterolog reportyor genining tarjimasini bostiradi. Sutemizuvchilar turlari orasida saqlanishiga qaramay, bu inhibitiv ta'sir uchun uORFning peptid ketma -ketligi talab qilinmaydi. Aksincha, HER-2 mRNKiga yuklangan ribosomalarning aksariyati, ehtimol, uORFni tarjima qiladi va keyinchalik AUG kodonining quyi qismida qayta tiklay olmaydi, bu qisman interkistriklararo masofa tufayli. Ribosomalarning oz qismi HER-2 boshlanish kodoniga yuqori oqim AUG kodonidan oqishsiz skanerlash orqali yoki qisqa interkronik mintaqaga qaramay, uORFni tarjima qilib qaytadan ishga tushirish orqali kirishadi. Ushbu natijalar shuni ko'rsatadiki, HER-2 uORF bu onkoproteinning sintezini quyi oqim boshlash joylariga ribosoma kirishini cheklash orqali nazorat qiladi.


Evolyutsion tarzda saqlangan uORF sichqonlar, chivinlar va ko'k rangli orkinoslarda PGC1a va oksidlovchi metabolizmni tartibga soladi.

Mitokondriyal farovonlik va funktsiya metabolik moslashuv paytida qattiq nazorat qilinadi, lekin diabet, neyrodejeneratsiya, saraton va buyrak kasalligi kabi patologik holatlarda tartibga solinmaydi. Biz bu erda mitokondriyal biogenez va oksidlanish metabolizmasining asosiy gubernatori PGC1a -ning tarjimasi o'z genining 5 'tarjima qilinmagan hududida (PPORGC1A) yuqori oqimdagi ochiq o'qish doirasi (uORF) bilan salbiy tartibga solinganligini ko'rsatamiz. Biz uORF vositachiligidagi tarjima repressiyasi PPARGC1A ortologlarining odamdan uchishgacha bo'lgan xususiyatidir. Ajablanarlisi shundaki, PPARGC1A baliq ortologlarida bir nechta inhibitiv uORFlar keng tarqalgan bo'lsa -da, ular mitoxondriyal tarkibi juda yuqori bo'lgan Atlantika ko'kfuna orkinosida umuman yo'q. Sichqonlarda PPARGC1A uORF ni buzadigan muhandislik mutatsiyasi PGC1a protein darajasini va oksidlovchi metabolizmni oshiradi va o'tkir buyrak shikastlanishidan himoya qiladi. Ushbu tadqiqotlar oksidlovchi metabolizmni tartibga soluvchi translyatsion tartibga soluvchi elementni aniqlaydi va uning organizm mitoxondriyal funktsiyasi evolyutsiyasiga qo'shgan salohiyatini ta'kidlaydi.

Kalit so'zlar: 5 'tarjima qilinmagan mintaqa PGC1a bluefin orkinosining evolyutsiyasi ishemik buyrak shikastlanishi metabolizm mitoxondriya oksidlovchi fosforillanish translyatsion regulyatsiyasi yuqoridagi ochiq o'qish doirasi.


Materiallar va uslublar

Xamirturush shtammlari va plazmidlari

Xamirturush hujayralari avval tavsiflanganidek o'zgartirildi [56] va transformatorlar auksotrofik marker/s ga mos keladigan ozuqa moddalari bo'lmagan tegishli muhitda tanlangan. Tadqiqotda ishlatiladigan shtammlar va plazmidlarning batafsil ro'yxati Qo'shimcha 2 -faylda keltirilgan: navbati bilan S1 va S2 -jadvallar. The upf1D shtammi ilgari tasvirlangan [24]. Plasmid sr. yo'q. 1–8 [4] da tasvirlangan, plazmid sr. yo'q. 9-10 [21] da tasvirlangan va plazmid sr. yo'q. 11 [26] da tasvirlangan.

Biokimyoviy tahlillar

Dual-lusiferaza tahlili avval aytib o'tilganidek amalga oshirildi [4, 20], ba'zi kichik o'zgartirishlar bilan. Yovvoyi tipdagi/mutant xamirturush hujayralari nazoratchi (R AUG FF AUG) yoki test muxbiriga (R AUG FF XXX) ega (1a-rasm) to'yinganlikka qadar bir kechada o'stirildi. Keyin hujayralar kerakli ODga erishish uchun suyultirildi600 sinovdan o'tgan haroratda (masalan, 20 ° C, 30 ° C) 16 soat ichida 0,6-0,8. Luciferaza faolligini hisoblash uchun 50 ml 1 × passiv liziz buferiga (Promega #E1941) 2 ml madaniyat qo'shildi, u o'quvchi plastinkasida ajratilgan (Corning #CLS3912), so'ngra xona haroratida 50 min. Luciferaza faolligi 24 ° C da Turner Modulus Microplate Reader yordamida o'lchandi. Qisqacha aytganda, 50 ml F-Luc reaktivi (15 mm Tris pH 8.0, 25 mM glitsilglisin, 4 mM EGTA, 15 mM MgSO4, 1 mM DTT, 2 mM ATP, 0,1 mM CoA va 75 mkM lusiferin) har bir quduqqa qo'shilgan. Faoliyat kechikish vaqti bilan (reaktivni yuborish va o'lchash o'rtasidagi vaqt) 2 soniya va integratsiya vaqti (bir quduq uchun o'lchash davomiyligi) 1 soniya bilan o'lchandi. Xuddi shu quduqdagi R-Luc faolligi darhol 50 ml R-Luc reagentini qo'shib o'lchandi (0,22 M limon kislotasi-natriy sitrat pH 5, 1,1 M NaCl, 2,2 mM Na2EDTA, 1,3 mm NaN3, 0,44 mg/ml BSA, 1,43 mkM koelenterazin) F-Luc bilan bir xil o'lchov sozlamalari bilan. Firefly luciferase (F-Luc) ning nisbiy faolligi FF AUG /R AUG (AUG) yoki FF UUG /R AUG (UUG) qiymatlarini olish uchun Renilla lusiferaza (R-Luc) faolligini normalizatsiya qilish yo'li bilan hisoblab chiqilgan. Boshlanish kodoni sifatida UUG dan boshlangan olovbardosh lusiferazasining normallashtirilgan faolligini hisoblash uchun FF UUG/R AUG qiymati UUG/AUG nisbati uchun FF AUG/R AUG ga normallashtirildi. Boshqa yaqin qarindosh kodonlarning normallashtirilgan ifodasi (masalan, ACG, AUU) xuddi shunday tarzda hisoblab chiqilgan.

To'liq hujayrali ekstraktlarda (WCE) b-galaktosidaza faolligi tahlillari ilgari tasvirlanganidek amalga oshirildi [57]. EIF1 ifodasini tahlil qilish uchun (kodlangan SUI1) Western blot tahlillari yordamida WCElar ilgari tasvirlangan [58] denaturing sharoitida to'rtta biologik replikatdan (mustaqil transformantlar) qilingan. Immunoblot tahlili [59] eIF1 [60] va Ded1 (Tien-Ssien Changning o'ziga xos sovg'asi) ga qarshi antikorlar yordamida amalga oshirildi. Xuddi shu ekstraktlar yordamida ikkita texnik takrorlash amalga oshirildi va har bir ekstraktning ikki barobar turli miqdori ketma-ket ikkita qatorga yuklandi. ProteinSimple tasvirlagichi (FluorChem tizimlari #FM0261) yordamida immun komplekslarni aniqlash uchun kengaytirilgan xemiluminesans (Amersham #RPN2106) ishlatilgan va tasvirning [61] inversiyasidan so'ng Adobe Photoshop yordamida signal intensivligi densitometriya orqali aniqlangan.

Ribosoma profilini aniqlash

Hujayra madaniyati va lizis

pR AUG FF UUG plazmidini o'z ichiga olgan BY4741 hujayralari (R-Luc (AUG)-F-Luc (UUG) bilan ikki tomonlama lusiferaza muxbiri) URA3 Ribosomalar profilini tuzishda vektor (2 -qo'shimcha fayl: S2 -jadvalga qarang) ishlatilgan, u ta'riflanganidek bajarilgan [8, 19, 30, 62] ba'zi o'zgartirishlar bilan. Etti yuz ellik millilitr xamirturush hujayralari log bosqichida (OD600 0,6-0,8) 20 ° C, 30 ° C yoki 37 ° C haroratda urasil bo'lmagan (SC-Ura) sintetik muhitda o'stirilgan, 16 soat davomida tez (≤ ​​1 min) vakuumli filtrlash orqali yig'ib olinadi. suyuq azotda muzlatilgan. Sikloheksimiddan kelib chiqadigan artefaktlarning oldini olish uchun hosilni yig'ishdan oldin ommaviy axborot vositalariga sikloheksimid qo'shilmagan [31,32,33,34]. Shundan so'ng muzli sovuq lizis buferi qo'shildi (20 mM Tris [pH 8.0], 140 mM KCl, 1.5 mM MgCl2, 1% Triton, 500 mkg/ml sikloheximid). Bu lizis buferidagi sikloheximid kontsentratsiyasi lizis va qayta ishlash jarayonida tarjimaning uzayishini minimallashtirish uchun dastlab ribosomalarni profilaktika qilish tajribalarida [8] ishlatilgan kontsentratsiyadan besh baravar ko'p edi. Lizis buferidagi muzlatilgan granulalar muzlatgichli tegirmonda lizing qilindi (Freezer/Mill® Ikki kamerali kriogen silliqlash mashinasi, №6870, 15 sikl sozlamalari bilan, 15 Gts chastotada, 5 daqiqa oldindan sovutish, 1 daqiqa ishlash, keyin 2 daqiqa sovutish). Muzlatilgan lizat 50 ml konusli trubkaga o'tkazildi va tez-tez qo'zg'alib muz ustida eritildi. Hujayra lizatasi 3000 rpm (Eppendorf # 5810R), 4 ° C da 5 daqiqa davomida santrifüj qilindi va supernatant yig'ilib, 13 000 rpm da santrifüj qilindi (

18000 rcf) stol usti santrifugasida (Eppendorf #5417R) 4 ° C da 10 min. Oxirgi supernatant yig'ildi va OD260 o'lchandi. 30 OD o'z ichiga olgan lizatning alikvotlari260 birliklar ishlatilgunga qadar -80 °C da saqlangan.

Kutubxonaga tayyorgarlik ketma -ketligi uchun 80S ribosomal izlarini ajratish

30 OD ni o'z ichiga olgan lizatning bir qismi260 birliklar muzda eritildi va 500 U RNKaz I (Ambion™ #AM2294) bilan 60 daqiqa davomida 26 °C da termomikserda 700 aylanish tezligida ishlov berildi. Reaksiyaga beshta mikrolitrli SUPERaz-RNAse inhibitori (Ambion ™ #AM2694) qo'shildi, keyinchalik u ilgari ta'rif etilganidek 80S monosomalarini ajratish uchun ishlatildi [30]. Qisqacha aytganda, 80S monosomasini ajratish uchun reaktsiya liziz tamponida tayyorlangan 10-50% (w/v) sukroz gradientiga yuklandi, so'ngra SW 41 Ti rotorida 40 000 rpmda 3 soat davomida santrifüj qilindi. Qismlar zichlik gradienti fraksiyasi tizimida (Brandel) gradientlarni pompalash uchun 60% saxaroza eritmasi (lizis buferida tayyorlangan) yordamida ajratildi. 80S ga to'g'ri keladigan fraktsiyalar yig'ilib, ribosoma bilan himoyalangan mRNK bo'laklari (RPF) SDS/issiq kislotali fenol va xloroform bilan tozalanadi.

RNK-seq kutubxonasini tayyorlash uchun umumiy mRNKni ajratish

Umumiy RNK lizatdan ishlab chiqaruvchining protokoli bo'yicha miRNeasy Mini Kit (Qiagen #217004) yordamida ajratilgan. Tasodifiy parchalanish parchalanish reagentini (Ambion #AM8740) qo'shish va 70 °C da 8 daqiqa davomida inkubatsiya qilish, so'ngra to'xtash eritmasini (xuddi shu to'plamdan) qo'shish orqali amalga oshirildi.

Kutubxona qurilishining ketma-ketligi

Ribosoma bilan himoyalangan fragmentlar (RPF) va parchalangan umumiy mRNK har biri 15% TBE-karbamid jelida (Novex #EC68852BOX) elektroforez orqali hal qilindi. O'lchovni tanlagandan so'ng, RNK jel ekstraktsiyasi qilindi va polinukleotid kinaza (NEB #M0201S) yordamida fosforillandi. Umumjahon miRNA klonlashtiruvchi biriktiruvchisi (NEB # S1315S) PEG 8000 (2,5% w/v), DMSO va SUPERase ishtirokida T4 RNK Ligaz 2 (NEB # M0242 L) yordamida RNKning 3 'uchlariga bog'langan. 37 ° C da 2,5 soat davomida. Bog'langan mahsulotlar 15% TBE-karbamid jelida elektroforez yo'li bilan hal qilindi va tegishli o'lchamdagi bo'laklar jeldan elutsiya qilindi. RPFlardan olingan bog'lovchi bilan bog'langan RNK to'g'ridan-to'g'ri teskari transkripsiyaga duchor bo'ldi, parchalangan umumiy RNK namunalaridan olingan esa rRNKlarni olib tashlash uchun Ribozero reaktsiyasi (Illumina Ribo-Zero Gold rRNKni olib tashlash to'plami - xamirturush) uchun kirish sifatida ishlatilgan va keyinchalik ta'sirlangan. teskari transkripsiya uchun. Denatüre - teskari nusxa ko'chirish uchun, 10-ul RNK, [(Phos) AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC (SpC18) CACTA (SpC18) TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG "5] 1,25 uMdir ​​teskari nusxa ko'chirish astar 2 ml bilan aralashtirib oldingi reaktsiya dan (10 mm Tris pH 8.0 erigan) 80 °C da 2 minut va muz ustida inkubatsiya qilinadi. Buning ortidan SuperScript ™ III teskari transkriptaza (#AM2694), dNTP, DTT va Superase-In qo'shilib, 48 ° C da 30 daqiqa inkubatsiya qilindi. RNK shabloni 2,2 ml 1 N NaOH qo'shilishi bilan olib tashlandi, so'ng 98 ° C da 20 min inkubatsiya qilindi. Reaksiya 15% TBE-Urea jelida hal qilindi va jeldan cDNA chiqarildi. CircLigase (Epicenter #CL4111K) yordamida tsirkulyarizatsiya 15 ml cDNA (10 mM Tris pH 8.0 da eritilgan) 2 ml 10 × CircLigase buferi, 1 mL 1 mM ATP, 1 mkl 50 mM MnCl bilan aralashtirish orqali amalga oshirildi.2va 1 ml CircLigase. Reaksiya 1 soat davomida 60 ° C da inkubatsiya qilindi, so'ngra 80 ° C da 10 daqiqa davomida issiqlik inaktivatsiyasi amalga oshirildi.

Dairesel shaklidagi mahsulotlar umumiy RNK namunasining PCR amplifikatsiyasi uchun andozalar sifatida ishlatilgan yoki RPF kutubxonalarida rRNKdan olingan ketma-ketlikni olib tashlash uchun avval subtraktiv gibridizatsiyaga uchragan. Ikkinchisi uchun, sirkulyarizatsiya reaktsiyasi 2 × SSC (#AM9763) ishtirokida biotinlangan oligonukleotidlarni [62] ajratish havzasi bilan aralashtirildi, 90 ° C da 100 ° C da denatüre qilindi, keyin 37 ° C da tavlandi. Keyin reaksiya Dynabeads bilan aralashtirildi va 37 ° C da termomikserda 1000 rpm da inkubatsiya qilindi. Eluat qaytarib olindi va rRNK-susaygan namuna sifatida ishlandi. Ikkinchisi, shuningdek, umumiy RNKdan olingan aylanma mahsulot, shtrix kodlarida ozgina o'zgarishlar bilan ilgari nashr etilgan primerlar [62] yordamida ketma-ketlik kutubxonalarini ishlab chiqarish uchun PCR kuchaytirilishi uchun shablon sifatida ishlatilgan. Olingan kutubxonalar Illumina HiSeq tizimi yordamida DNKning ketma -ketligi va genomikasi yadrosi, NHLBI, NIHda tartiblangan. O'qishlar bog'lovchi ketma-ketliklarni olib tashlash uchun kesilgan (tegishli buyruq qatori kodida fastx_toolkit/fastx_trimmer [http://hannonlab.cshl.edu/fastx_toolkit/index.html] yordamida) va keyin moslashtirilgan. S. cerevisiae Bowtie yordamida rRNK ma'lumotlar bazasi [63]. Ma'lumotlar bazasiga mos kelmaydigan o'qishlar (rRNK bo'lmagan o'qishlar) ga moslashtirildi S. cerevisiae genom yoki TopHat [64] yordamida F-Luc muxbiri mRNA-ga moslashtirishni yaratish uchun xabarchi ketma-ketligidan (pR AUG FF UUG) tuzilgan FASTA fayliga.

Ma'lumotlarni tahlil qilish, statistika va veb -vositalar

Ribosoma profilini yaratish uchun har bir tajriba biologik replikatsiya sifatida ikkita mustaqil madaniyat bilan o'tkazildi. Replikatlar orasidagi statistik tahlil DESeq2 [65] yordamida amalga oshirildi DESeq2 statistik toʻplami minglab genlar boʻyicha oʻqishlar sonining farqlari haqidagi maʼlumotlarni birlashtirib, har bir holat uchun faqat ikkita biologik replikatsiyaga ega boʻlish kabi keyingi avlod sekanslash tajribalarida odatiy muammoni hal qiladi. shunga o'xshash ekspressiya darajasidagi genlar uchun sonlar xilma -xilligini modellashtirish maqsadida tahlil qilinadi. Modellashtirilgan tafovutlar umumiy chiziqli model (GLM) doirasida qo'llaniladi, bu chiziqli regressiyaning kengaytmasi bo'lib, u noodatiy xatolarni taqsimlashga imkon beradi, ifoda o'zgarishlarini aniqlash va o'zgarishlar kattaligiga ishonch oraliqlarini joylashtirish, shuningdek, genlarni ko'rsatuvchi genlarni istisno qilish uchun. g'ayritabiiy darajada yuqori o'zgaruvchanlik. Ko‘p faktorli dizaynda genotip yoki dori-darmon bilan davolash kabi eksperimental o‘zgaruvchilarga qo‘shimcha ravishda omillardan biri sifatida kutubxona turini (mRNA-Seq yoki Ribo-Seq) kiritish orqali transkripsiyaviy va translyatsion o‘zgarishlar GLMda birgalikda tahlil qilinishi mumkin. Tarjima samaradorligi (TE) Ribo-seq kutubxona turining mRNA-Seq boshlang'ichiga ta'siri sifatida paydo bo'ladi va TE ning eksperimental o'zgaruvchilar bilan sezilarli o'zaro ta'siri translyatsion nazoratni ko'rsatadi [66]. Tahlil ikki yoki uchta biologik replikatsiya bilan etarli darajada quvvatlanmagan bo'lsa-da, faqat yolg'on ijobiy emas, balki yolg'on negativlar ehtimoli oshadi. DESeq2 yordamida biz har xil haroratda ribosoma zichligi (har bir million xaritada o'qilgan ribosoma himoyalangan bo'laklari), mRNK zichligi (million xaritaga RNK-sek o'qiladi) va tarjima samaradorligi (TE, ribosoma zichligi/mRNK zichligi) o'zgarishini hisoblab chiqdik. O'rtacha mRNK ≥ 10 kesimidan foydalanib, to'rtta namunada o'qiladi. uORF ning TE ni hisoblash uchun (TEuORF), mORF uchun mRNK o'qish soni faqat uORFda mRNK o'qish sonidan ko'ra ishlatilgan, chunki mORFlar shovqini pastroq. Spearman korrelyatsiyasi https://www.wessa.net/rwasp_spearman.wasp saytidagi onlayn vosita yordamida hisoblab chiqilgan. Tishli quti va moʻylov uchastkasining tahlili http://shiny.chemgrid.org/boxplotr/ veb-vositasi yordamida oʻtkazildi. Chiziqlar ± 1,58 × chorak oralig'ini (IQR)/indicate ko'rsatadin, bu erda IQR - 75- va 25 -foizlar orasidagi farq n bu qutidagi ma'lumotlar nuqtalari sonini ifodalaydi. Bir-biriga mos kelmaydigan chiziqlar 95% ishonch hosil qiladi, bu ikkita mediananing farqiga. Issiqlik xaritalari "Heatmapper" veb -vositasi yordamida yaratilgan (http://www.heatmapper.ca/) [67].

Yo'llarni qimirlatish

Birlashtirilgan hizalanish fayli (Bam fayli) ikkita moslashtirish fayli yordamida yaratilgan (ikkita biologik replikatsiya uchun bittadan). Birlashtirilgan fayllar RPF namunalari uchun ham, umumiy RNK namunalari uchun ham (20 ° C, 30 ° C va 37 ° C uchun) yaratilgan. Wiggle fayllari ushbu birlashtirilgan hizalama faylidan yaratilgan. Fayllar Uotson yoki Krik strandidagi har bir gen uchun yaratilgan. Treklar Integrative Genomics Viewer (IGV 2.4.14) yordamida tasvirlangan. Yo'llar birlashtirilgan faylda o'qilgan xaritalarning umumiy soniga qarab normallashtirildi. MRNK darajasidagi o'zgarishlarning ta'sirini normalizatsiya qilish uchun o'qish normallashgan jami cho'qqilar mRNK darajasidagi o'zgarishlarni tarjima samaradorligini o'zgartirishini aks ettirish uchun o'lchandi ("Natijalar" bo'limiga qarang). mRNK darajalaridagi o'zgarishlar bo'yicha masshtabli va miqyosisiz silkinish izlari ko'rsatilgan.

Yuqori oqimdagi ORFlarni topish

Mumkin bo'lgan UORFlarni aniqlash va ularning tarjimasini yuqorida aytib o'tilganidek tajribamizda tasdiqlash uchun biz ham shunday yondashdik [19]. Birinchidan, taxmin qilingan tarjima qilingan UORFlar asosan tasvirlanganidek aniqlandi [35]. Qisqacha aytganda, AUG yoki qarindosh kodonlardan boshlanadigan izohli 5'-UTR-lardagi barcha ochiq o'qish ramkalari uchun RPF nisbati +1 pozitsiyasida (uORF boshlang'ich kodoni)-1 pozitsiyaga (boshlang'ich kodonning yuqorisida) to'g'ri keladi. hisoblab chiqilgan. UTF va gt 4 nisbatiga ega bo'lgan, & gt 14 RPF bilan + 1 va - 1 pozitsiyalarda hisoblangan va hisobning kamida 50% boshlang'ich saytga nisbatan 0 kadrda o'qiladi (ya'ni, tegishli kod qatori) -c15-r4-z0.5), keyingi tahlil qilish uchun tanlangan. Biz potentsial uORFlarni aniqlash uchun foydalanilgan bir nechta ribosoma profillash ma'lumotlar to'plami ilgari tasvirlangan [19] va NCBI Gen Expression Omnibusga taqdim etilgan va ulanish raqamlari https://elifesciences.org/articles/31250/figures#supp1 manzilida keltirilgan. 2 -qo'shimcha faylda: S2 -jadval. RNK-seq ma'lumotlari GEO kirish raqami GSE137021 bilan NCBI Gene Expression Omnibus (GEO https://www.ncbi.nlm.nih.gov/geo) ga topshirildi. Ushbu tadqiqotda ishlab chiqarilgan RNA-seq va Ribo-seq ma'lumotlar to'plamlari tafsilotlari 2-qo'shimcha faylda keltirilgan: S5-jadval.

Tajribalarimizda ushbu taxmin qilingan UORFlardan qaysi biri tarjima qilinganligini aniqlash uchun biz 3-nukleotidlarning davriyligi va RFF sonlarining bir xil taqsimlanishini baholash mezonlari sifatida ishlatadigan ORF identifikatorini (RibORF) ishlatdik [36]. Biz 0,5 bashorat qilish ehtimolini o'rtacha qattiq chegarasini qo'lladik va 1 yoki undan ko'p o'sish haroratida tarjima dalillari bo'lgan uORFlarni aniqlash uchun 3 xil haroratda o'stirilgan barcha 6 ta biologik replikatlarning izlari kutubxonalaridan hosil qilingan birlashtirilgan faylni ishlatdik. 3 kodondan qisqa uORFlarni chiqarib tashlaganimizdan so'ng, biz AUG bilan boshlangan 1367 ta uORFni aniqladik (N = 142) yoki NCC (N = 1225). 5'-UTR, uORF yoki mORFda umumiy mRNK va RPF sonlarini hisoblash avval tasvirlanganidek qilingan [19].

Hamma xamirturushli mRNA 5'-UTR transkriptomidagi potentsial uORFlarni aniqlash uchun 5 m-RNK uchun 5'-UTR ketma-ketligi chiqarildi va 5'-UTR davomida har bir AUG va NCC nukleotid uchliklari qidirildi. Biz uORFning oxiri sifatida har bir boshlang'ich kodon uchun ramkadagi to'xtash kodonini aniqladik. 5′-UTR da ramka ichidagi to'xtash kodoni bo'lmagan uORFlar uchun biz 5′-UTR ning oxirini uORF ning oxiri sifatida aniqladik. Uzunligi 3 dan kam kodonga ega uORFlar quyi oqim tahlilida chiqarib tashlandi.

Ning C-terminal HA-belgili klonlarini yaratish AGA1 gen

Gibson assembly master mix (NEB# E2611) C-terminal HA-belgili yaratish uchun ishlatilgan AGA1 klonlar [AGA1-HA (WT), №12 plazmidga qarang, 2-qo'shimcha fayl: S2-jadval]. To'rt-oltita fragmentli yig'ilishlar uchun protokol ishlatilgan. O'rnatilgan to'rtta bo'lak quyidagicha: ikki qatorli HA yorlig'i (

108 nt), yuqori nusxali vektor (pRS426 BamHI va SacI bilan hazm qilingan, keyin gel ekstraktsiyasi), PCR mahsuloti (P1,

3000 bp) boshlang'ich kodonidan 650 nt yuqoriga bog'laydigan to'g'ridan-to'g'ri primer va to'xtash kodonining darhol quyi oqimida (Krik ipida) teskari primer yordamida olingan. AGA1 kodlash hududi va PCR mahsuloti (P2, 300 bp) stop -kodonning quyi oqimida to'g'ridan -to'g'ri oldinga siljish va teskari primer bilan 300 nt to'xtash kodonining yuqori qismida (Crick ipida) AGA1 kodlash hududi. Astarlar kichik o'zgarishlar bilan NEBuilder yig'ish vositasi (v2.2.5) yordamida ishlab chiqilgan. BY4741 hujayralaridagi genomik DNK barcha PCR reaktsiyalarida ishlatilgan. To'rt bo'lakning hammasi jel bilan ajratilgan va keyin ishlab chiqaruvchining ko'rsatmalariga muvofiq 2 × Gibson master aralashmasi yordamida bog'langan. Bir mikrolitr yig'ish NEB® 5-alpha Competentga aylantirildi E. coli-yuqori samarali hujayralar (#C2987), so'ngra LB-karbenitsillin plitalari ustida tanlov. Koloniyalar M13F (M13F) va M13 teskari (M13R) primerlari yordamida PCR koloniyasi yordamida tekshirildi, so'ngra M13F va M13R primerlari yordamida cheklash xaritasi va ketma -ketligi o'rnatildi. uORF-start mutant [AGA1-HA (Mutant), plazmid #13 ga qarang, 2-qo'shimcha fayl: S2-jadval] dan yaratilgan AGAPfuTurbo DNK polimeraza (Agilent Technologies #600252) yordamida tez o'zgaruvchan PCR yordamida 1-HA (WT) plazmid. Mutatsiya M13F astar bilan ketma -ketlik bilan tasdiqlangan. WT yoki mutant plazmidlarni saqlaydigan xamirturush hujayralari oksotrofik belgilarga mos keladigan ozuqa moddalari bo'lmagan tegishli muhitda tanlangan. Xamirturush xujayralari kulturalari, lizat tayyorlash va g'arbiy blot tahlillari yuqorida ta'riflanganidek amalga oshirildi. C-terminalli HA-tagli Aga1 oqsili Invitrogen (#26183) dan HA tegli monoklonal antikor (2-2.2.14) yordamida aniqlandi.


Qo'llab -quvvatlovchi ma'lumotlar

Shakl S1

UORF ichida LST1 1B eksoni evolyutsiya bilan saqlanib qolgan. A) ni solishtirish LST1 uORF4 ning yuqori oqimidan (qizil, qalin) boshlanadigan va asosiy ORF ning boshlang'ich kodonida (qora, qalin) tugaydigan bir nechta homologlarga ega ekson 1B-2 ketma-ketligi. Ketma-ketlik pan trogloditlarida yuqori darajada saqlanadi (tartibga kirish raqami <"type":"entrez-nucleotide","attrs":<"text":"XM_003950777.1","term_id":"410040514","term_text": "XM_003950777.1" >> XM_003950777.1, 100% identifikatsiya) va makaka mulatta (NW 001116486.1, 95% identifikator). Bundan tashqari, ketma-ketlik qisman sus scrofa-da saqlangan (<"type": "entrez-nucleotide", "attrs": <"text": "NC_010449.4", "term_id": "347618787", "term_text": ") NC_010449.4 ">> NC_010449.4, 76% identifikatsiya, 16 bo'shliq) va bos taurus (<" type ":" entrez-nucleotide "," attrs ": <" text ":" NC_007324.5 "," term_id ") :"355477170","term_text":"NC_007324.5">> NC_007324.5, 74% identifikatsiya, 8 ta boʻshliq). Shunisi e'tiborga loyiqki, sus scrofa va bos taurusda uORF4 ning to'xtash kodoni saqlanmaydi. B) UORF4 tomonidan kodlangan aminokislotalar ketma-ketligini bir nechta gomologlar bilan taqqoslash. Bu ketma -ketlik trogloditlar (100% identifikatsiya) va makaka mulatta (89% identifikatsiya) da yuqori darajada saqlanadi. Biroq, sus scrofa (67% identifikatsiya, 5 bo'shliq) va bos taurus (39% identifikatsiya, 2 bo'shliq) da ketma -ketlik qisman saqlanib qolgan. E'tibor bering, bos taurusda uORF4 homo sapiensnikiga qaraganda uzunroq (45 ta 38 ta aminokislotaga nisbatan) va to'xtash kodonining yo'qligi sababli uSF scrofa asosiy ORF bilan chegaralanadi, shuning uchun uORF emas, balki uAUGni tashkil qiladi.

S2 -rasm

Ushbu tadqiqotda ishlatiladigan ekspression vektorlar. Ushbu tadqiqotda ishlatilgan ifoda vektorlarining umumiy ko'rinishi. Ko'rsatilgan ketma-ketliklar klonlash uchun ishlatiladigan pEGFP-N1 vektorli cheklovchi fermentlarni kesish joylarining ko'p klonlash joyiga (MCS) klonlangan. Exon ketma-ketligi va pEGFP-N1 MCS markirovka qilingan, uORF4 va asosiy EGFP ORF ning boshlang'ich kodoni kul rang bilan ajratilgan. UORF4 va asosiy ORF bilan kodlangan aminokislotalar nuklein kislotasi ketma -ketligi ostida ko'rsatilgan. E'tibor bering, barcha konstruktsiyalarda exon 2 da ATG mavjud va ORF7 kodlangan, bu exon barcha LST1 transkriptlarida mavjud, shuning uchun uning ishlatilishi ushbu tadqiqotda o'rganilgan mexanizmlar bilan tartibga solinmagan. Exon 1B-2 va 1C-2 ketma-ketligini pEGFP-N1 vektoriga klonlash natijasida yuqori oqimda joylashgan 14 ta nukleotid yo'q qilindi. LST1 asosiy ORF. Ushbu ifoda vektorlarida EGFP ORF dan oldin pEGFP-N1 MCS dan 19 ta nukleotid mavjud. Exon1B-EGFP, Exon1B-AUGdel-EGFP va Exon1B-frameshift-EGFP ekspresion vektorlari intron 1A uchun 23 bp uzunlikdagi ketma-ketlikni o'z ichiga oladi, bu nashr etilgan exon 1B ketma-ketligining noaniqligidan kelib chiqadi. Bu erda ko'rsatilgan ketma-ketlik [10] ga muvofiq etiketlanadi, ammo ikkinchi tadqiqot ekson 1B ketma-ketligini 23 bp yuqori oqimdan boshlash uchun xabar beradi [8].

S3 -rasm

The LST1 exon 1B ketma -ketligi oqsil ekspresiyasini inhibe qiladi. HeLa hujayralari qizil lyuminestsent oqsil mCherry va EGFP ekspression vektori yoki Exon1B-EGFP termoyadroviy konstruktsiyasini ifodalovchi konstruktsiyalardan in vitro transkripsiyalangan RNK (ivt RNK) bilan kotransfektlangan. (A) Exon1B-EGFP ivt RNK (sariq chiziq) yoki EGFP ivt RNK (ko'k chiziq) ni ifodalovchi HeLa transfektantlarida EGFP intensivligini oqim sitometriyasi tahlili. Transfekte qilinmagan hujayralar qattiq kulrang egri shaklida ko'rsatiladi. MCherry ifodasi EGFP ifodasi intensivligi uchun tahlil qilingan musbat transfektanlarni ajratish va tanlash uchun ishlatilgan. (B) HeLa transfektantlarida EGFP ifodasining miqdoriy oqim sitometriyasi tahlili. EGFP ifodasini tahlil qilish (A) da tasvirlanganidek bajarildi va o'rtacha floresans intensivligi aniqlandi. O'zgartirilmagan EGFP vektoridan ivt RNK bilan transfektsiyalangan hujayralar uchun 100% qiymati o'rnatildi. 3 mustaqil tajribaning o'rtacha qiymatlari ustunlar ichida ko'rsatilgan +/− s.d. Exon1B-EGFPni ifoda etuvchi transventantlar, EGFP RNK ivt bilan transfektsiya qilingan hujayralar bilan solishtirganda, EGFP ifodalanish darajasini sezilarli darajada pasaytirdi (p   = 𠂠.049).

S4-rasm

uORF ichida LST1 exon 1B oqsil ekspresiyasini inhibe qiladi. HEK-293T cells were cotransfected with expression constructs encoding the red fluorescent protein mCherry and either an EGFP expression vector, Exon1B-EGFP, Exon1B-AUGdel-EGFP or Exon1B-frameshift-EGFP fusion constructs. (A, B) Flow cytometry analysis of EGFP intensity in HEK-293T transfectants expressing Exon1B-EGFP (yellow line), Exon1B-AUGdel-EGFP, Exon1B-frameshift-EGFP (green line in A and B, respectively) or the unmodified EGFP vector (blue line). Untransfected cells are displayed as a solid grey curve. The mCherry expression was used to gate and select positive transfectants, which were analysed for the intensity of EGFP expression. (C, D) Quantitative flow cytometry analysis of EGFP expression in HEK-293T transfectants. The analysis of EGFP expression was performed as described in (A, B) and the mean fluorescence intensity was quantified. A value of 100% was set for cells transfected with the unmodified EGFP vector. Mean values from 5 independent experiments are indicated within the columns +/− s.d. Transfectants expressing Exon1B-EGFP displayed significantly reduced EGFP levels when compared with cells transfected with the empty vector (p =𠂠.009). The expression of the Exon1B-AUGdel-EGFP vector, in which the start codon of the uORF was mutated, was comparable to the expression of the unmodified construct. Expression of the Exon1B-frameshift-EGFP construct, in which a frameshift mutation shortens the uORF, was significantly stronger when compared to cells transfected with the Exon1B-EGFP vector (p =𠂠.049), but still considerably weaker than the expression of the unmodified vector.

Figure S5

Quantification of EGFP transcript expression in transfectants using qPCR. HeLa (A) and HEK-293T (B) cells were transfected with either an EGFP expression vector, Exon1B-EGFP, Exon1C-EGFP, Exon1B-AUGdel-EGFP or Exon1B-frameshift-EGFP fusion constructs. Total RNA was isolated from transfectants and cDNA was synthesised. Miqdori EGFP transcripts was assayed by quantitative PCR. EGFP transcript expression was first normalised for GAPDH and then for expression of the neomycin resistance gene. The later was performed to compensate for fluctuations in transfection efficiency, as the neomycin resistance gene is present in all expression vectors. A value of 100% was set for cells transfected with the unmodified EGFP vector. Mean values from 3 independent experiments are indicated within the columns +/− s.d. Both HeLa and HEK-293T cells transfected with either the unmodified EGFP expression vector or any of the fusion constructs employed in this study displayed comparable EGFP transcript levels.


RESULTS

Previously, we have demonstrated that VEGF can be generated through both AUG initiated translation and cleavage of a larger L-VEGF precursor protein that is initiated from one of multiple upstream, in frame CUG codons (25). In order to detect differences between translational initiation at AUG and CUG codons for each VEGF mRNA splice variant, we constructed expression plasmids containing VEGF 121, VEGF 165 or VEGF 189 with mutated signal peptide sequences (40).

The VEGF 121 AUG shut-off requires the full-length mRNA sequence

Using this approach, we have demonstrated that translation initiation at a CUG is always efficient regardless of which splice variant is expressed, whereas initiation at the AUG depends upon which exons are present in the mRNA (40). VEGF 121 is expressed through initiation events using the CUG start codons, which only generate high molecular weight L-VEGF. In contrast, VEGF 189 and 165 splice variants lead to the production of both CUG and AUG-initiated proteins ( Figure 2 A).

To determine how the alternatively spliced VEGF sequence influences the initiation-codon choice, we fused the first exon of VEGF, containing the 5′UTR, in-frame AUG start codon and mutated signal peptide, with the CAT reporter gene and inserted at the 3′ end the sequence corresponding to exons 5 to 8 of VEGF 121, 165 or 189. Translation initiation still occurred at both CUG codons and the AUG codon, disregardless of the VEGF sequence fused at the 3′ end ( Figure 2 B). This shows that the mere presence of the VEGF 121 isoform specific primary sequence was not sufficient to reproduce the AUG blockade. We can conclude that the VEGF 5𠄸 alternative exons influence the choice of the initiation codon only in the context of the full length VEGF mRNA. Consequently, we hypothesized that the AUG shut-off in the VEGF 121 mRNA depends upon RNA structures that require continuity from the 5′UTR to the vicinity of the stop codon. These results highlight the role of the full VEGF mRNA sequence in this regulation and suggest that there is something specific within the VEGF 121 isoform sequence that inhibits AUG initiated translation.

Role of the 5′UTR in the VEGF 121 AUG shut-off mechanism

It was previously established that an alternative promoter is positioned within the human VEGF 5′UTR (15). The +1 transcription initiation site is located at +633 downstream from the classical start site. Furthermore, the internal promoter's insensitivity to hypoxia indicates that it is used independently of the main promoter region. Moreover, transcripts initiated from the internal promoter are of special interest because they cannot encode L-VEGF isoforms. In addition, these transcripts can be translated by either a cap-dependent or IRES-A-dependent mechanism from the AUG codon (15).

The role of the two 5′ sequences was investigated by comparing the expression of each splice variant fused to the different 5′UTRs. A deletion of most of the VEGF 5′UTR (24 remaining nucleotides) was used as a control ( Figure 3 , lanes 2). VEGF 165 and 189 AUG initiated form was expressed, disregardless of the length of the 5′UTR ( Figure 3 A), while VEGF 121 AUG initiated form was only detectable from the control construct ( Figure 3 A, VEGF 121, lane 2). The integrity of all mRNAs expressed after transfection was verified by northern blot (Supplementary data). Quantification of these mRNAs was determined by RNase protection assays ( Figure 3 ). For each spliced variant, we can see that VEGF mRNAs are expressed at comparable levels, indicating that the lack of the 121 AUG initiated form ( Figure 3 A lanes 1 and 3) is due to a posttranscriptional regulation.

To examine this regulation in a more physiological context, minigene plasmids were constructed (see materials and methods). These minigene constructs should allow, after alternative splicing of the pre-mRNA, the expression of the different VEGF isoforms. While alternative splicing generating VEGF 189 was very inefficient in HeLa cells, results obtained with VEGF 121 and 165 parallel those obtained with the cDNA constructs ( Figure 3 B) and only the construct lacking a 5′UTR permitted expression of the VEGF 121 AUG initiated form ( Figure 3 B, lane 2). Since we have previously shown that the half-lives of the VEGF 121, 165, and 189 proteins are very similar (40), we investigated whether this regulation was exerted through a translational regulation mechanism and we examined the association of the different transcripts with polysomes. For transfections using full-length constructs ( Figure 4 , lane 1𠄳), mRNAs associated with polysomes were recovered. Identical results were obtained with constructs in which VEGF 165 and 189 transcripts began at the internal promoter ( Figure 4 , lanes 4, 5). The same construction with VEGF 121 clearly showed a very poor association of this mRNA to polysomes ( Figure 4 , lane 6). Because the northern blot is not discriminative enough to identify the different VEGF mRNA isoforms, we analyzed the VEGF mRNA distribution by RT–PCR after transfection with the IP minigene construct. Interestingly, VEGF 165 mRNA was present in fractions containing heavy polysomes, whereas the 121 encoding mRNA was found to be recovered only in the free mRNA, monosome and disome fractions ( Figure 4 , lane 7). These results corroborate those obtained with cDNA transfections and reinforce the previous finding showing that the AUG shut-off mechanism of VEGF 121 is independent of the splicing mechanism.

The minimal 5′ region involved in the control of the AUG usage contains a small ORF

A deletion analysis was performed to locate the minimal sequence responsible for the AUG translational blockade of VEGF 121 starting with the region between position 633 (IP) and 24 nt upstream from the AUG ( Figure 5 A). It is clear that the 200 nt upstream from the AUG were sufficient to mediate the specific AUG blockade of VEGF 121 ( Figure 5 A, lanes 4) and the region between 100 and 200 was necessary for this effect ( Figure 5 A, lanes 3 versus 4). These results were confirmed by those obtained with the minigene constructs ( Figure 5 A).

Identification of the minimal region involved in translation initiation control. (A) Left, schematic representation of the deletion within the 5′ leader performed in the IP constructs encoding the three VEGF isoforms and the minigene. Right, expression of AUG-initiated VEGF isoforms were analyzed by western immunoblotting using an anti-HA antibody. Anti-β-actin was used to control protein loading. RPA analyses were performed to normalize transfection with a vector specific probe to quantify mRNA from transfection and with a β-actin probe to control RNA quantity. (B) Partial alignment of the VEGF mRNA 5′ untanslated region of several species. Conserved nucleotides are shown in red. Main VEGF AUG translation initiation codons (on the right) are framed. The lower part shows a magnification of the region containing the uORF. The uORF, extremely well conserved among several species, is positioned in +1 frame relative to the VEGF ORF in human mRNA. This uORF would be initiated at uAUG (position 852) and be terminated at position 863, 175 nucleotides upstream from the VEGF AUG, and would produce a putative three amino-acid long polypeptide.

It is well documented that the 5'UTRs of vertebrate mRNAs contain a variety of features that affect the translation efficiency of the main coding sequence (44). These include the length and putative secondary structures of the 5'UTR, the sequence context of the initiation codon as well as the presence of upstream AUG codons (uAUGs). Interestingly, inspection of the human VEGF 5’UTR revealed the presence of a unique and short uORF precisely within the region between 200 and 100 nucleotides upstream of the AUG initiation codon. This uORF is highly conserved between species ( Figure 5 B) and begins at AUG 852, which is 186 nucleotides upstream from the main AUG (using the human sequence).

We first investigated whether this uORF was translated. Since it is impossible to visualize the encoded tripeptide, the uORF stop codon was mutated so that initiation at the uAUG would generate a 62 AA amino-terminally extended VEGF. This extended VEGF protein was always detected ( Figure 6 , lane 1) demonstrating that the uAUG was efficiently used whatever the splice variant. A consequence of this construction is the loss of the VEGF AUG 1038 initiated form.

Role of the uORF in the translational initiation control. Left, schematic representation of construct with uORF mutation. The internal promoter beginning constructs encoding each VEGF isoform or the VEGF minigene either with wild type uORF (pIP121mSPHA, pIP165mSPHA, pIP189mSPHA and pIPminiVEGF numbered 3), a mutated uORF AUG (pIP121mORFmSPHA, pIP165mORFmSPHA, pIP18mORFmSPHA and pIPminiVEGFmORF numbered 2) or a mutated uORF stop codon, which made the uORF in frame with the VEGF-HA (pIPmSOmSP121HA, pIPmSOmSP165HA, pIPmSOmSP189HA and pIPminiVEGFmSO numbered 1). Right, expression of AUG-initiated VEGF isoforms and uORF were analyzed by western immunoblotting using an anti-HA antibody and anti-β-actin to control loading of protein. RPA analyses were performed to normalize transfection with a vector specific probe to quantify mRNA from transfection and with a β-actin probe to control RNA quantitation.

To gain an insight into the role of the uORF, we mutated the uAUG. This mutation increased AUG 1038 initiation translation of VEGF 121 isoform, but had no effect on the VEGF 165 or 189 expression level ( Figure 6 , lanes 2 and 3). Remarkably, results obtained with the minigene construct exactly parallel those achieved with the cDNA constructs ( Figure 6 , right panel).

Taken together, these data demonstrate that the uORF serves as a cis acting regulatory element for VEGF protein isoform expression.

Translation of the uORF is mostly cap-independent

Since the uORF is located within IRES-A, we investigated whether the uAUG was translated by a cap- or IRES-dependent mechanism. In order to accomplish this, we performed a knockdown directed against the cap-binding protein eIF4E using a validated siRNA. As shown in Figure 7 , the eIF4E knockdown inhibited most of the synthesis of the 121 or 189 control constructs (Ct) in which the IRES sequences were deleted. Remarkably, expression from the VEGF 189 AUG in a wild-type ( Figure 7 , WT) context was unaffected by the inhibition of cap-dependent translation indicating that the VEGF AUG is completely IRES-dependent. As expected, the VEGF 121 AUG initiated form remained undetectable ( Figure 7 , WT). Finally, we can see that the uAUG is principally cap-independent for both the 121 and 189 constructs ( Figure 7 , mStop). One can postulate that the uAUG is able to exhaust small ribosomal subunits recruited at the cap site, since modest cap-dependent initiation was detected downstream, at the VEGF AUG ( Figure 7 , mStop).

Translation of the uORF after eIF4E knockdown. Left, schematic representation of construct with uORF mutation (described in the legend of Figure 6). Right, following eIF4E (+) or control (−) siRNA transfection, expression of AUG-initiated VEGF 121 and 189 isoforms constructs (schematized on the left) were analyzed using an anti-HA antibody and anti-β-actin to control loading of protein. Anti-eIF4E was used to verify knockdown efficiency. RPA analyses were performed to normalize transfection with a vector specific probe to quantify mRNA from transfection and with a β-actin probe to control RNA quantitation.


Muhokama

Understanding of molecular mechanisms regulating utrophin expression may have therapeutic benefit because of utrophin’s potential to functionally compensate dystrophin deficiency in DMD. Two to four fold upregulation of utrophin is believed to be sufficient for complete amelioration of dystrophic phenotype in the disease [8, 39]. Although transcriptional control of utrophin expression is relatively well documented, its upregulation level sufficient for therapeutic benefit has never been reached. This may be due to inefficient translation of utrophin-A, the muscle specific isoform. Translational repression of utrophin-A is mediated through two major components: 3' and 5'-UTRs. Regulation through 3'-UTR could at least partially be explained by miRNA targets and AU rich element [22, 25–27]. However, 5'-UTR mediated repression of utrophin-A is quite puzzling, primarily because of its reported IRES activity [23]. In the same 5'-UTR simultaneous existence of inhibitory property and IRES, the cis-acting element mostly associated with translational upregulation demands in depth understanding. The present work is an effort towards this direction.

The evidence in favor of utrophin-A IRES came from DNA based dicistronic construct based assay. In the dicistronic construct insert to be tested is flanked between two reporter ORFs and two cistrons remain under the control of single but strong promoter. Expression of second cistron has been considered as the proof of IRES activity. In this strategy although second cistron is expressed for IRES elements, cryptic promoter and alternative splicing may also lead to the same. Therefore all the IRESes identified through dicistronic DNA construct based strategy, especially of cellular origin are now under question. We therefore tested utrophin-A 5'-UTR with more stringent strategy [28, 29, 33]. Luciferase reporter having 5'-UTR was in vitro transcribed, either m7G-capped or A-capped and then expression of reporter was monitored upon transfection in cultured cells. A-capped RNA cannot be translated through cap-dependent mechanism and therefore any activity of reporter represents its cap-independent translation. With A-cap we detected almost 80% activity of m7G-capped transcript (Fig 1). However the overall activity is quite low compared to EMCV IRES. We therefore conclude that firstly, utrophin-A 5'-UTR although confers IRES activity, it is not as strong as EMCV counterpart and secondly, its contribution becomes enormous because of severe repression of cap-dependent translation.

In order to investigate utrophin-A 5'-UTR mediated inhibition of cap-dependent translation, we asked whether any region within it confers repressor activity. With deletion mutagenesis, we addressed this issue using in vitro transcribed reporter RNA. Transfection based reporter assay identified two regions whose deletion upregulated expression of downstream reporter with m7G-capped transcript. These two sequences in utrophin-A 5'-UTR therefore inhibit cap-dependent translation. Our result suggests that

125 nt long region at 5’terminus is crucial for severe inhibition in cap-dependent and has no effect on IRES. Its deletion upregulated

25 fold reporter activity. This 125 nt sequence has predicted complex secondary structure and presence of structural elements close to 5' end inhibits binding of 40S ribosomal subunit with cap [40]. Another region, present between 255–302 nt in 5'-UTR moderately inhibits cap-dependent translation, however it seems important for IRES (Fig 3).

Investigations on upstream ORF (uORF) within 5'-UTR for many transcripts have demonstrated their inhibitory effect on translation [41]. In mouse utrophin-A 5'-UTR a short uORF is present. We therefore asked whether this uORF in utrophin-A 5'-UTR confers any inhibitory effect on downstream ORF. Elimination of utrophin-A uORF upregulated downstream reporter activity with m7G-capped RNA. It therefore identified another inhibitory element in utrophin-A 5'-UTR (Fig 4).

In conclusion, the present study demonstrates that utrophin-A 5'-UTR supports cap-independent translation. Utrophin-A IRES although not as strong as EMCV IRES, in the context of severe repression of cap-dependent translation, plays crucial role. The inhibition of cap-dependent translation is mediated through two cis-acting sequence elements and one short uORF. Among these three elements the sequence element present at 5' terminus appears most potent. The observations presented in this paper may therefore lead to the development of strategies to de-repress utrophin translation.


Kirish

The human genome contains many regions encoding potential functional small peptides outside the canonical protein-coding regions 1 . Some upstream open reading frames (uORFs), which are located in the 5′-untranslated regions (5′-UTRs) of mRNAs, have been shown to encode such functional small peptides 2,3,4,5 . uORFs are cis-acting regulatory elements that control the translation of protein-coding main ORFs (mORFs) in various ways 6,7 . In eukaryotes, 43S pre-initiation complexes (PICs) scan for a start codon along an mRNA from the 5′ end. Therefore, PICs can recognize the start codon of a uORF and translate the uORF before reaching the downstream mORF. In many cases, after translating a uORF, ribosomes dissociate from the mRNA or small ribosomal subunits remain bound to the mRNA and resume scanning. When ribosomes dissociate from the mRNA after uORF translation, ribosomes that have translated the uORF do not translate the downstream mORF. Therefore, if the translation initiation efficiency of the uORF is high, the uORF exerts a substantial repressive effect on mORF translation 6,7 . When a small ribosomal subunit resumes scanning after uORF translation, the ribosomes can reinitiate translation at a downstream AUG codon. However, the reinitiation efficiency depends on the time needed for the uORF translation and the distance between the uORF stop codon and the downstream start codon 8,9,10,11 . The intercistronic distance required for efficient reinitiation depends on cellular availability of the ternary complex that comprises eukaryotic initiation factor 2 (eIF2), GTP, and Met-tRNAi Met , and the level of the available ternary complex is reduced under starvation or stress conditions 12 . These properties are utilized for the translational regulation of yeast GCN4 and mammalian ATF4 va ATF5 mRNAs 13,14,15,16,17,18 . In these mRNAs, there is an inhibitory uORF downstream of the uORF that allows reinitiation. Under normal conditions, reinitiation preferentially occurs at the start codon of the inhibitory uORF, and therefore, mORF translation is repressed. In contrast, under starvation or stress conditions, reinitiation is delayed due to the reduced availability of the ternary complex, and therefore, ribosomes more frequently bypass the inhibitory uORF and reinitiate translation at the start codon of the mORF, resulting in enhanced mORF translation. Apart from mORF translation control, uORFs can affect mRNA stability through the nonsense-mediated RNA decay pathway 19 . While the effects of most uORFs on the expression of the mORF-encoded proteins are independent of the uORF-encoded sequences, certain uORFs repress mORF translation in a peptide sequence-dependent manner. Most of these uORFs encode regulatory peptides that cause ribosome stalling by interacting with components of the ribosomal exit tunnel during uORF translation 4 . Ribosome stalling on a uORF results in translational repression of the downstream mORF because the stalled ribosomes block the scanning of subsequently loaded PICs and prevent them from reaching the start codon of the mORF 20 . In some genes, uORF-encoded peptides are involved in translational regulation in response to metabolites or environmental stresses, whereby the uORF translation initiation efficiency or the efficiency of ribosome stalling is regulated in a condition-dependent manner 4,21 . In the sequence-dependent regulatory uORF of the mouse antizyme inhibitor (AZIN1) gene, which begins with a non-canonical start codon 22 , polyamine induces ribosome stalling, and the stalled ribosome causes ribosome queuing by blocking the scanning of PICs 23 . This ribosome queuing promotes translation initiation at the non-canonical start codon of the uORF by positioning PICs near the start codon, thereby enhancing the repressive effect of the uORF on mORF translation. Apart from uORFs encoding regulatory peptides, some uORFs have been reported to code for proteins with functions independent of the control of the downstream mORF 24,25,26 .

To comprehensively identify uORFs encoding functional peptides or proteins, genome-wide searches for uORFs with conserved peptide sequences (CPuORFs) have been conducted using comparative genomic approaches in plants 27,28,29,30,31,32 . To date, 157 CPuORF families have been identified by comparing 5′-UTR sequences among plant species. Of these, 101 families were identified in our previous studies by applying our original methods, BAIUCAS 29 and ESUCA (an advanced version of BAIUCAS) 32 to the genomes of Arabidopsis, rice, tomato, poplar, and grape.

ESUCA has many unique functions 32 , such as efficient comparison of uORF sequences among an unlimited number of species using BLAST, automatic determination of taxonomic ranges of CPuORF sequence conservation, systematic calculation of Ka/Ks ratios of CPuORF sequences, and wide compatibility with any eukaryotic genome whose sequence database is registered in ENSEMBL 33 . By comparing uORF sequences from certain species and those from many other species whose transcript sequence databases are available, ESUCA enables more comprehensive identification of CPuORFs conserved in various taxonomic ranges than conventional comparative genomic approaches, in which uORF sequences are compared among limited numbers of selected species. In addition, to distinguish between “spurious” CPuORFs conserved because they encode parts of mORF-encoded proteins and “true” CPuORFs conserved because of the functional constraints of their encoded small peptides, ESUCA assesses whether a transcript containing a fusion of a uORF and an mORF is a major or minor form among homologous transcripts 32 . By using these functions, ESUCA is able to efficiently identify CPuORFs likely to encode functional small peptides. In fact, our recent study demonstrated that poplar CPuORFs encoding regulatory peptides were efficiently identified using ESUCA by selecting ones conserved across diverse eudicots 32 .

Several studies on genome-wide identification of animal CPuORFs have been reported. By comparing uORF sequences between human and mouse, 204 and 198 CPuORFs have been identified in human and mouse, respectively 34 . In addition, by comparing uORF sequences among several species in dipteran, 44 CPuORFs have been identified in fruit fly 35 . More recently, among translatable uORFs identified by ribosome profiling studies, 118, 80, 13, 50, and 37 CPuORFs in human, mouse, zebrafish, fruit fly, and nematode, respectively, have been identified by Mackowiak et al. 36 , and 97 CPuORFs in human have been identified by Samandi et al. 26 . In these previous studies, uORF sequences were compared between a limited number of species. Therefore, further comprehensive identification of animal CPuORFs was expected by applying the approach using ESUCA to animal genomes. In addition, the relationships between the taxonomic ranges of CPuORF conservation and the likelihood of having a regulatory function have not been studied in animals.

Accordingly, in this study, we applied ESUCA to the genomes of fruit fly, zebrafish, chicken, and human to exhaustively identify animal CPuORFs and to determine the taxonomic range of their sequence conservation. Using ESUCA, we identified 1517 animal (1373 novel and 144 known) CPuORFs belonging to 1430 CPuORF families. Using transient expression assays, we examined the effects of 17 CPuORFs conserved in various taxonomic ranges on mORF translation. Through this analysis, we identified seven novel regulatory CPuORFs that repress mORF translation in a sequence-dependent manner.


Electronic supplementary material

12864_2009_2749_MOESM1_ESM.PDF

Additional file 1: Genes containing uAUGs that do/do not interact with 3'-ends of conserved miRNAs. GO-term analysis for two categories of genes that contain uAUGs. The first category consists of genes with uAUGs that are predicted to interact with 3'-ends of conserved miRNAs (likely targets). The second category of genes contains uAUGs but shows no such interactions. (PDF 57 KB)

Predicted interactions between uAUG 6 and 7 (Table 5) of

Additional file 2: KLF9 and conserved miRNAs. uAUG6 and uAUG7 are thought to be responsible for limiting translation of KLF9 in HeLa cells but not in N2A. Predicted binding between both ends of conserved miRNAs in Table 5 and the two uAUGs are shown. (PDF 116 KB)