Ma `lumot

Gibsonni yig'ish uchun astar dizayni

Gibsonni yig'ish uchun astar dizayni



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Men Gibson assambleyasi uchun astar loyihalashga harakat qilyapman. Mening qiziqishim geni plazmidda va men bu genni nusxalab, uni boshqa plazmidga joylashtirmoqchiman.

Men PCR uchun primerlarimni qanday loyihalashtirishni bilmayman. Bilaman, menga 2 ta primer to'plami kerak (jami 4 ta).

  1. Mening genimni ushlab turgan plazmiddan nusxa ko'chirish uchun oldinga va orqaga primer.
  2. Plazmidni nusxalash uchun orqaga va oldinga primer.

Men shuni bilamanki, men o'z genim va uni joylashtirmoqchi bo'lgan plazmid o'rtasida bir -birini to'ldiruvchi hududlarni yaratishim kerak. Buni qanday qilaman?

Mana plazmid va gen. Men genni biobrick prefiksi va qo'shimchasi orasiga joylashtirmoqchiman.

Mana, menga kerak bo'lgan astarlar:

Men genni joylashtirmoqchi bo'lgan plazmid uchun mening primerlarim bo'lishi kerak

  • Oldinga:ATTCGCGGCCGCTTCTAGAG
  • Teskari:CTGACGCGGCCGCTACTAGTA

Genni nusxalash va bir-biriga o'xshashlikni qo'shish uchun primerlar

  • Teskari:ATCATTTCAAATTCGTCCATCTCTAGAAGCGGCCGCGAAT
  • Oldinga:AATTAGAAAGAGATTATAATACTAGTAGCGGCCGCTGCA

Mana gen

Mana men uni joylashtirmoqchi bo'lgan plazmid. Men genetikani ishlataman, lekin menimcha, bu maqsadda so'z yaxshi ishlaydi.


Rad etish: Men hech qachon Gibson assambleyasini qilmaganman, lekin bu erda astarlaringizni qanday loyihalash haqida nazariy tushuncham bor. Sizga vektor va qo'shimchadan olingan va siz yaratmoqchi bo'lgan birikmalarga mos keladigan har biri 20 bp segmentlardan iborat to'rtta 40mer kerak. Quyidagi diagrammada nuqtali chiziqlar har bir 40merning ikkita 20 bp segmentlari o'rtasidagi birikmalarni ifodalaydi.


Bu erda Gibson assambleyasini ishlatishda primer dizaynini ko'rib chiqishning yaxshi ko'rinishi. http://j5.jbei.org/j5manual/pages/22.html


Gibson yig'ish uchun primer dizayni - Biologiya

Asbob uzunligi 60 nukleotid (nt) bo'lgan astarlarni yaratadi. Har bir primer shablonni tavlash uchun 20 nt genga xos ketma-ketlikni va 30-40 nt ketma-ketlik ketma-ketligini o'z ichiga oladi, ular ikkita qo'shni bo'laklar orasidagi gomologik qoplamani hosil qilish uchun ishlatiladi.

40 bp gomologik ketma -ketlik

Gibson Assembly® Primer Dizayn vositasi parchalarga gomologik qoplamalarni qo'shish uchun ishlatiladigan primerlarni ishlab chiqaradi, bu esa ularni samarali yig'ishga imkon beradi. Primerlar uzunligi 60 nukleotidga o'rnatiladi va shablonni tavlantirish uchun genga xos ketma-ketlikning 20 nukleotidini o'z ichiga oladi. Vektor va qo'shilish birikmasi o'rtasida siz hazm qilishni cheklash uchun uzunligi 10 ntgacha bo'lgan ketma -ketlik motifini kiritishingiz mumkin. Natijada, PCR kuchaytirilgandan so'ng, 30 dan 40 bp gacha gomologik qoplama hosil bo'lishi mumkin. Qatlamning o'lchami 10 kb gacha bo'lgan har bir bo'lakni yoki har biri 1 kb gacha bo'lgan qo'shimchali 15 ta bo'lakni qo'llab -quvvatlash uchun etarli. Katta genlarni yig'ish uchun gomologik qoplamani kengaytirish tavsiya etiladi.


Gibson assambleyasining umumiy ko'rinishi

Gibsonni yig'ish texnikasi birinchi bo'lib 2009 yilda Doktor Daniel Gibson va J. Kreyg Venter institutining hamkasblari tomonidan tasvirlangan. Bu erda Addgene biz bu variantni 2014 yilda depozit jarayonida klonlashning keng tarqalgan variantlari menyusiga qo'shdik, chunki u foyda keltirdi. mashhurlikda. Gibson majmuasi DNKning bir nechta chiziqli bo'laklarini oson yig'ishga imkon bergani bilan mashhur, lekin quyidagi rasmda ko'rsatilgandek, siz tanlagan vektorga qo'shimchani asosiy klonlashda ham foydalanish mumkin. Boshlash uchun sizda odatda PCR yordamida hosil bo'ladigan gomologiya hududlari bo'lgan DNK bo'laklari bo'lishi kerak. Keyin bo'laklar uch xil fermentni o'z ichiga olgan fermentlar aralashmasi bilan inkubatsiya qilinadi:

  • parchaning 5 'uchlarini chaynalgan ekzonukleaza, uzoq cho'zilgan joylarni hosil qiladi, bu esa homologiyaga ega bo'lgan bitta torli hududlarni yumshatishga imkon beradi.
  • bo'shliqlarni to'ldirish uchun polimeraza
  • tavlangan va to'ldirilgan bo'shliqlarni yopish uchun DNK ligazasi

Bu fermentlar aralashmasining katta qismi shundaki, ularning barchasi bir xil haroratda ishlashi mumkin, shuning uchun 50 ° C haroratda reaksiya bir soat yoki undan kam davom etadi. Bir soat yoki undan ko'proq vaqt o'tgach, namuna darhol vakolatli hujayralarga aylanishga tayyor. Fermentlarning asosiy aralashmasini kompaniyadan sotib olish mumkin (masalan, NEB yoki SGI-DNK) yoki o'zingiz aralashtirishingiz mumkin (masalan, Miller laboratoriyasi protokoliga qarang). Gibsonni yig'ish jarayonidan bir bosqichda 6 tagacha bo'lakni yig'ish uchun foydalanish mumkin, natijada chandiqsiz yig'ish mumkin bo'ladi, buning uchun maxsus cheklash joylari (yoki ularning etishmasligi) yoki jiddiy vaqt majburiyati talab qilinmaydi. Yana bir afzalligi shundaki, bu jarayon ketma -ket emas, bir vaqtning o'zida yovvoyi turdagi va mutant konstruktsiyalarni yaratishni osonlashtiradi.


Gibson Assambleyasi - cheklovli fermentlarni ishlatmasdan, bo'laklarni plazmidga kiritishning mashhur usuli. Ushbu usulni simulyatsiya qilish uchun SnapGene intuitiv interfeysni taqdim etadi.

Gibson Assambleya uchun PCR DNK segmentlarini kengaytirib, bir -biriga o'xshash uchlarini hosil qiladi. Keyin kuchaytirilgan mahsulotlarni yig'ish fermentlari bilan inkubatsiya qiling va aralashmani bakteriyalarga aylantiring.

SnapGene astar dizaynini avtomatlashtirish orqali Gibson Assambleyasini soddalashtiradi. Gibson Assambleyasi reaktsiyasini rejalashtirish uchun siz qo'shmoqchi bo'lgan DNK bo'laklarini tanlang va SnapGene mos primerlarni tanlaydi.

Bu saytlar Gibson Assambleyasi haqida qo'shimcha ma'lumot beradi:

"SnapGene bizga Gibson yig'ilishlarini rejalashtirish va klonlashni cheklash bosqichlarini rejalashtirishda, shuningdek mukofotga sazovor bo'lgan promouterlar kollektsiyasining dizaynida bizga ko'p yordam berdi. O'ylaymanki, biz dasturiy ta'minotdan foydalanmagan kun yo'q edi.


Gibson Assembly Wizard yordamida klonlash

Assambleya ustasiga kirish uchun avval ketma-ketlik faylini oching. Ekranning pastki qismida siz Split Workspace yonida montaj ustasini topasiz. O'rnatish ustasini bosing, so'ngra Yangi majlis yaratish -ni tanlang. Taqdim etilgan variantlarda Gibson -ni tanlang va yig'ishni davom ettirish uchun Boshlash -ni bosing.

Magistral ketma-ketlikni oching va orqa miya uyasiga bosing. Orqa miya ketma -ketligini cheklangan fermentni kesish joyi bilan lineerlashtirish uchun kesilgan joyni bosing, Shift tugmachasini bosing va yana bosing. Magistralni o'rnatish uchun Fragmentni o'rnatish tugmasini bosing.

Keyingi qo'shish ketma -ketligini oching va Qo'shish uyasini bosing. Qo'shimchaning barcha asoslarini tanlang. Birinchi qo'shimchani o'rnatish uchun Fragmentni o'rnatish -ni bosing.

Boshqa qo'shimchani qo'shish uchun montaj ustasining o'ng tomonidagi + tugmasini bosing. Keyingi qo'shimchani oching va yangi Qo'shish uyasini bosing. Shunga qaramay, barcha qo'shimchalar asoslarini tanlang. Ikkinchi qo'shimchani o'rnatish uchun Fragmentni o'rnatish tugmasini bosing.

Agar siz xohlagan ikkita qo'shimchaga "kozak" kabi ajratuvchi ketma -ketlikni qo'shishni xohlasangiz, keyin bo'sh joy qo'shish tugmasini bosing. Spacerni "kozak" deb nomlang va uning asoslarini gccacc ga o'rnating. Spacer ketma-ketligini o'rnatish uchun Saqlash tugmasini bosing.

Yig'ish tugallangach, yig'ilish nomini o'zingiz xohlagan konstruksiya nomiga o'zgartiring va montaj ustasining o'ng tomonidagi Assemble tugmasini bosing.

Navbat papkasi va primer jild uchun kerakli papka o'rnini tanlang. O'rnatishni yakunlash uchun Yaratish tugmasini bosing.

Yangi yig'ilgan konstruktsiyani oching va ketma -ketlikni ko'rish uchun tarix panelini bosing. E'tibor bering, yig'ilgan ketma -ketlikdagi orqa miya va qo'shimchalar rangli.

O'rnatish haqida umumiy ma'lumotni ko'rish, chop etish yoki astarlarni eksport qilish uchun Assambleyani oching.

Agar siz biron bir ketma -ketlikni primer bilan bog'lash saytida almashtirsangiz, Benchling astarni avtomatik ravishda yangilaydi va mutatsiyani Assambleyaning "Mos kelmaydigan joylar" jadvalida ko'rsatadi.

O'rnatilgan ketma -ketlikni moslashtirishni yoki o'zboshimchalik bilan tahrirlashni yoqish uchun, "Yig'ish" yorlig'ini oching va o'ng tomonning yuqori qismida "Yakunlash" tugmasini bosing.

Eslatma: O'rnatish ustasi homologiya qo'llari orqa miya/qo'shimchaga kiritilishini kutmaydi, chunki ular bir -biriga birlashtirilgan.


Ma'lumotnomalar

Xyuz RA, Ellington AD. Sintetik DNK sintezi va yig'ilishi: sintetikni sintetik biologiyaga kiritish. Sovuq Bahor Harb Perspect Biol. 20179(1):1–17.

Ellis T, Adie T, Bolduin GS. Sintetik biologiya uchun DNK yig'ilishi: qismlardan yo'llargacha va undan tashqarida. Integr Biol (Camb). 20113(2):109–18.

Cobb RE, Ning JC, Zhao H. Tabiiy mahsulotlarning keyingi avlod kombinatorial biosintezi uchun DNKni yig'ish texnikasi. J Ind Microbiol biotexnol. 201441(2):469–77.

Chao R, Yuan Y, Zhao H. DNKni yig'ish texnologiyalarining so'nggi yutuqlari. FEMS xamirturush Res. 201515 (1): 1–9.

Juhas M, Ajioka JW. Sintetik biologiya uchun yuqori molekulyar og'irlikdagi DNKni in vivo yig'ish. Crit Rev Biotechnol. 201737(3):277–86.

Liang J, Liu Z, Low XZ, Ang EL, Zhao H. Twin-primer enzimatik bo'lmagan DNK birikmasi: samarali va aniq ko'p qismli DNK yig'ish usuli. Nuklein kislotalari. 201745: e94.

Jin P, Ding V, Du G, Chen J, Kang Z. DATEL: termostabil ekzonukleazalar va Ligazadan foydalangan holda DNKni chandiqsiz va ketma-ket yig'ish usuli. ACS Synth Biol. 20165 (9): 1028-32.

Gibson DG, Young L, Chuang RY, Venter JC, Xatchison CA 3, Smit XO. Bir necha yuz kilobazagacha DNK molekulalarining fermentativ yig'ilishi. Nat usullari. 20096 (5): 343-5.

Engler C, Gruetzner R, Kandzia R, Marillonnet S. Oltin darvoza aralashtirish: II turdagi cheklash fermentlariga asoslangan DNKni aralashtirishning bitta qozonli usuli. PLoS One. 20094 (5): e5553.

Bitinaite J, Rubino M, Varma KH, Schildkraut I, Vaisvila R, Vaiskunaite R. USER bilan do'st DNK muhandisligi va urasil eksizatsiyasi yordamida klonlash usuli. Nuklein kislotalari. 200735 (6): 1992–2002.

de Kok S, Stanton LH, Slaby T, Durot M, Xolms VF, Patel KG, Platt D, Shapland EB, Serber Z, Din J va boshqalar. Ligaza tsikl reaktsiyasi orqali DNKni tez va ishonchli yig'ish. ACS Synth Biol. 20143(2):97–106.

Shao Z, Zhao H. DNK assembler: tabiiy mahsulot gen klasterlarini tavsiflash va muhandislik qilish uchun sintetik biologiya vositasi. Usullari Enzimol. 2012517:203–24.

Li MZ, Elledge SJ. SLIC orqali rekombinant DNK hosil qilish uchun in vitro gomologik rekombinatsiyadan foydalanish. Nat usullari. 20074 (3): 251-6.

Zhang Y, Werling U, Edelmann W. SLiCE: yangi bakterial hujayra ekstraktiga asoslangan DNK klonlash usuli. Nuklein kislotalari. 201240 (8): e55.

Tillett D, Neilan BA. Fermentsiz klonlash: vektor cheklash fermenti saytlaridan mustaqil ravishda PCR mahsulotlarini klonlashning tezkor usuli. Nuklein kislotalari. 199927(19):e26.

Stevenson J, Krycer JR, Phan L, Brown AJ. Ligatsiyadan mustaqil klonlash usullarini amaliy taqqoslash. PLoS One. 20138(12):e83888.

Garsiya-Nafriya J, Uotson JF, Greger IH. IVA klonlash: bakterial in vivo yig'ilishdan foydalanadigan yagona quvurli universal klonlash tizimi. Sci Rep. 20166:27459.

Liu CJ, Jiang H, Vu L, Zhu LY, Meng E, Chjan DY. OEPR klonlash: katta va ko'p fragmentlar uchun samarali va uzluksiz klonlash strategiyasi. Ilmiy hisobot 20177: 44648.

Zeng F, Hao Z, Li P, Meng Y, Dong J, Lin Y. Mos keluvchi uchlarini yaratish uchun parallel ravishda ikkita bitta primerli PCR yordamida genlarni qayta tiklash uchun cheklovsiz usul. BMC biotexnol. 201717 (1): 32.

Cherezov V, Rosenbaum DM, Hanson MA, Rasmussen SG, Thian FS, Kobilka TS, Choi HJ, Kuhn P, Weis WI, Kobilka BK va boshqalar. Inson tomonidan ishlab chiqilgan beta2-adrenerjik G protein bilan bog'langan retseptorining yuqori aniqlikdagi kristall tuzilishi. Ilm. 2007318 (5854): 1258-65.

Ikeda H, Nonomiya T, Usami M, Ohta T, Omura S. Streptomyces avermitilisda poliketid anthelmintic makrolid avermektin uchun biosintetik gen klasterini tashkil etish. Proc Natl Acad Sci U S. A. 199996 (17): 9509–14.

Garrido LM, Lombo F, Baig I, Nur EAM, Furlan RL, Borda CC, Brana A, Mendez C, Salas JA, Rohr J va boshqalar. Anitratsiklin antitatsiklin kosmomitsinning biosintezi paytida glikosilatsiyalash bosqichlari haqidagi tushunchalar: ikkita glikosiltransferaza genining tavsifi. Mikrobiol biotexnologiyasi. 200673 (1): 122-31.

Piel J, Hertweck C, Shipley PR, Hunt DM, Newman MS, Moore BS. Dengiz izolati "Streptomyces maritimus" dan enterosin biosintezi gen klasterini klonlash, ketma -ketlik va tahlil qilish: aromatik poliketid sintazining izdan chiqib ketishining isboti. Chem Biol. 20007(12):943–55.

He J, Hertweck C. Aterotin biosintez gen klasterining poliketid yig'ilishi paytida molekulyar tahlil paytida dasturlashtirilgan hodisa sifatida takrorlanish. Chem Biol. 200310 (12): 1225-32.

Yurkovich ME, Tyrakis PA, Hong H, Sun Y, Samborskyy M, Kamiya K, Leadlay PF. Salinomitsin biosintezining kech bosqichli oralig'i biosintetik genlar klasteridagi o'ziga xos mutatsiya natijasida aniqlanadi. Kimyoviy kimyoviy. 201213 (1): 66-71.

Dagert M, Erlich SD. Kaltsiy xloridda uzoq vaqt inkubatsiya qilish ichak tayoqchalari kompetentsiyasini yaxshilaydi. Gen. 19796 (1): 23-8.


GeneArt Gibson Assembly Cloning texnologiyasining afzalliklari

GeneArt Gibson yig'ish EX to'plamlari bir nechta qo'shimchalarni yig'ish uchun idealdir.

Shakl 1. GeneArt Gibson Assembly EX klonlash to'plamlari ko'p sonli qo'shimchalardan foydalanganda yuqori konvertatsiya samaradorligi variantlarini ta'minlaydi. Invitrogen TOP10 vakolatli hujayralarga aylantirilgan pcDNA 3.4 da 0,5 kb hajmdagi 6, 8 va 10 ta bo'laklarni yig'ish.

GeneArt Gibson Assembly HiFi to'plamlari kichikroq bo'laklarni yig'ishning juda arzon va samarali usulini taklif qiladi. Katta yig'ilishlar uchun GeneArt Gibson EX Master aralashmalari va to'plamlari mavjud.

Shakl 2. GeneArt Gibson Assembly HiFi to'plamlari bir nechta qo'shimchalar dizayniga bitta qo'shimchani ishlatib yuqori klonlash samaradorligini ta'minlaydi. 1, 2 va 4 - 1kb bo'laklarni pCDNA 3.4 da TOP10 vakolatli hujayralar yordamida yig'ish. GeneArt Gibson Assambleyasi HiFi to'plamlari, ayniqsa, GeneArt Strings DNK bo'laklari yoki 100% ketma-ket, GeneArt Gen sintezi bilan ishlatilganda, katta yig'ilishlarni qurish uchun eng tejamli va vaqtni tejaydigan usuldir.


Gibson Assambleyasi qanday ishlaydi

Rekombinant DNK texnologiyasidan foydalanish DNK ligazasi va restriksion endonukleazalar topilganidan ko'p o'tmay boshlandi. Ko'p o'tmay, polimeraza zanjiri reaktsiyasining (PCR) paydo bo'lishi genomik DNKning murakkab aralashmasidan o'ziga xos DNK ketma-ketligini kuchaytirish uchun yangi imkoniyatlar ochdi. Bu texnologiyalar bir necha o'n yillar davomida zamonaviy ilmiy laboratoriyada asosiy tayanch bo'lib kelgan va bugungi kunda qimmatli yoki qiziqarli DNKni klonlashning foydali usullari bo'lib qolmoqda. Ammo, olimlar DNKning katta bo'laklari bilan ishlashga, genetik elementlarni keng miqyosda qayta ishlashga, butun genomlarni sintez qilishga va avtomatlashtirilgan yondashuvlarga o'tishga intilishar ekan, DNKni manipulyatsiya qilish uchun zarur bo'lgan texnologiyalar ham rivojlanishi kerak.

J. Kreyg Venter Instituti (JCVI) tergovchilari bir qator ishlab chiqdilar in vitro Qisqa oligonukleotidlarni DNKning ikkita torli yirik konstruktsiyalariga yig'ish uchun fermentativ strategiyalar [1-4]. 2003 yilda JCVI atigi 14 kun ichida bakteriyalarni yuqtiruvchi phiX174 virusining 5386 bp genomini yig'ish orqali sintetik genom ishlab chiqarishda sezilarli muvaffaqiyatga erishdi (5). Bu yondashuv sintetik oligonukleotidlarni polimeraza tsiklli birikmasi bilan birlashtirishni va keyinchalik ularni PCR (5-6) yordamida kuchaytirishni o'z ichiga oladi. Bu boradagi misli ko'rilmagan tezlik katta va murakkab genomlarni qurish uchun asos yaratdi.

2004 yilda JCVI sintez qila boshladi Mikoplazma genitalium genom Bir-biriga o'xshash DNK molekulalarini uchta ferment o'ziga xosligi yordamida samarali birlashtirish mumkinligi aniqlandi: (i) DNK bo'laklarining uchlarini chaynaydigan va ssDNK o'simtalarini ochadigan ekzonukleaza faolligi, ularning ssDNK komplementiga tavlana oladigan (ii) DNK polimeraza faolligi, tavlangan mahsulotlardagi bo'shliqlar va (iii) DNK ligaza faolligi, bu yig'ilishda hosil bo'lgan niklarni kovalent tarzda muhrlaydi. Ikki bosqichli termotsiklga asoslangan in vitro Ushbu fermentlardan foydalangan holda rekombinatsiya usuli 101 ta DNK kassetasini to'rt qismga birlashtirish uchun ishlatilgan. M. genitalium genom, har biri 136 kb dan 166 kb gacha. Ushbu muhim bosqich erkin tirik organizmdan olingan genomning birinchi yig'ilishini belgiladi. 582,970 bp da, bu sintetik genom laboratoriyada sintez qilingan kimyoviy jihatdan aniqlangan DNKning eng katta tuzilishi edi va ilgari sintez qilingan DNKdan 18 barobar katta edi (4).

O'shandan beri ikkita qo'shimcha in vitro rekombinatsiya usullari JCVI tomonidan 300 kb dan katta DNK molekulalarini bir bosqichda birlashtirish va klonlash uchun ishlab chiqilgan (2-4). Bu usullarning eng oddiyi-Gibson Assambleyasi, bir bosqichli izotermik usul bo'lib, u ilgari tasvirlangan uchta fermentativ faollikdan foydalanadi. Bu usul ssDNA va dsDNA larni birlashtirish uchun ishlatilishi mumkin.

Shakl 1. Gibson Assambleyasining umumiy ko'rinishi.


Gibson Assambleyasi eng ko'p ishlatiladiganiga aylandi in vitro Yuqorida muhokama qilingan yig'ish usullari, chunki u ishlatish uchun qulay, moslashuvchan va hatto katta, murakkab yig'ilishlar uchun ham juda kam yoki umuman optimallashtirishni talab qilmaydi. Gibson Assambleyasining asosiy aralashmasini mos keladigan va uchta fermentning mos aralashmasi bo'lgan DNK kiritish kifoya. Asosiy aralashmaga DNK bo'laklari qo'shiladi va 50 ° C da 1 soat davomida inkubatsiya qilinadi, natijada yig'ilgan mahsulot quyi oqimdagi dasturlar uchun mos bo'lgan to'liq muhrlangan dsDNA hisoblanadi (1 -rasm). JCVI, Gibson Assambleyasidan foydalanib, 60 bazali oligonukleotidlarning bir-birining ustiga o'ralgan 16520 bp sichqon mitokondriyal genomini tezda sintez qildi. Bundan tashqari, u 1,1 Mbp ni sintez qilish uchun xamirturush yig'ish bilan birgalikda ishlatilgan Mikoplazma mikoidlari birinchi sintetik hujayrani ishlab chiqarish uchun qabul qiluvchi hujayrada faollashtirilgan genom (1).


Konsolidatsiyalangan versiya uchun pastga qarang.

Plazmid xaritalarini tayyorlang

  • Sizning tugallangan dizayningiz qanday bo'lishi kerakligi haqida plazmid xaritasini tuzing
    • Bu kalit. Siz uni primer dizayni, primerlaringizni tekshirish, ketma-ketlik reaktsiyalarini baholash va hokazo uchun xohlaysiz. Men APE, ochiq kodli dasturlardan foydalanaman. Maslahatlar va hiyla -nayranglardagi maymunlardan foydalanish haqidagi sharhlarimni ko'ring.
    • Ko'pincha, bu boshqa plazmid ketma-ketliklaridan nusxa ko'chirish va yangi plazmid fayliga joylashtirishni anglatadi.
      • Biroq, siz primerlarda kodlash orqali promotorlar va ribosomalarni bog'laydigan saytlar kabi qisqa narsalarni qo'shishingiz mumkin.
      • Bundan tashqari, uzunroq (90+ bp) oligos yordamida DNKning uzunroq hududlarini qo'shishingiz mumkin
      • Siz genomik DNKdan foydalanishingiz mumkin, odatda butun hujayralardan (avval tozalash kerak emas)
      • Har bir genning RBS promouteriga ega ekanligiga ishonch hosil qiling va agar xohlasangiz kodonni to'xtating.
      • Agar siz o'zingizning ketma -ketligingiz bilan tanish bo'lmasangiz, ketma -ketlikda boshlang'ich doirasidagi to'xtash kodonlari yo'qligiga ishonch hosil qiling.
      • Astarlar tomonidan hosil qilingan bir -biriga o'xshashlikni o'z ichiga oling.

      Dizayn astarlari

      • Astar dizayni asosiy hisoblanadi. Agar sizning barcha PCRlaringiz sinovdan o'tgan barcha termotsikl sharoitlarida istalmagan chiziqlarsiz yaxshi hosil bersa, sizning yig'ilishingiz yaxshi o'tishi mumkin.
        • Astarlar bir -biridan bir necha oC gacha bo'lgan va DMSO kontsentratsiyasida bir necha tavlanish haroratida ishlasa, bu har doim yaxshi belgidir. O'rnatish bosqichi astar ketma -ketligiga va bitta torli DNK tuzilishining (soch qisqichlari va h.k.) yo'qligiga bog'liq bo'lgani uchun, PCRning qulayligi yig'ilish yaxshi o'tishi uchun yaxshi ko'rsatkichdir.
        • Agar sizning umurtqa pog'onangiz yaxshilanmasa yoki yonma -yon mahsulotlar bilan kuchaymasa va jel tozalashni talab qilsa, siz muvaffaqiyatli yig'ilishlarga ega bo'lmaysiz. Agar yomon PCR hosil bo'lsa, primer uchun biriktiruvchi hududning tavlanish haroratini > 72 o C ga oshirishni va iloji bo'lsa, bir-birining ustiga chiqish uchun vektorning turli joylaridan foydalanishni o'ylab ko'ring.
        • I har doim Tm >72 o C bilan primerlardan foydalaning tavlanadigan mintaqa uchun. Tm qiymatlar har doim Finnzymes veb-sayti tomonidan hisoblanishi kerak
          • Bu formula siz yig'adigan DNKni yaratish uchun ishlatiladigan DNK polimerazasi bo'lgan Phusion DNK polimeraza uchun amal qiladi.

          Dizayningizni ikki marta tekshiring

          • Oldindan va teskari astarlar buyurtma qilingan yo'nalishga mos kelishiga ishonch hosil qiling.
            • Bu qilish oson xato.

            Optimal shartlarni toping

            Shablon DNKni Dpn1 hazm qilish

            • Odatda Dpn1 qo'shilishi kerak shablon DNKni degradatsiya qilish uchun PCR tugagandan so'ng. Bu siz o'zgartirganda fon koloniyalari sonini kamaytiradi. Jel tozalash bo'laklari odatda kerak emas, lekin bu erda muhokama qilinganidek jel tozalashdan saqlanish kerak.
              • Bu shablonni o'tkazib yubormaslik uchun qilingan.
                • Agar sizning PCRlaringiz uchun shablonlar Kanamisin vektorlari bo'lsa va siz Kanamisin vektorini qurayotgan bo'lsangiz, transformantlaringizning bir qismi shunchaki shablon plazmidlari bo'lgan hujayralar bo'ladi. Buni keyinchalik skrining bosqichida yodda tutish kerak.
                • Agar sizda Amp plazmididan parcha bo'lsa va Kanamisin vektorini qurayotgan bo'lsangiz, Dpn1 qo'shishning hojati yo'q.

                Mening umurtqa pog'onamni ishlab chiqarish uchun 25 ul PCR reaktsiyasi uchun 0,5 ng shablon plazmid, keyin ustun tozalangan (jel tozalanmagan!) Va Dpn1 hazm qilmagan. Pushti koloniyalar - bu plazmid shabloni bo'lib, ustunni tozalash orqali yig'ilish reaktsiyasi va transformatsiyasiga o'tadi.

                Ogohlantirishlar

                • Agar siz bitta plazmiddan bir nechta bo'laklarni ko'paytirayotgan bo'lsangiz yoki primerlaringiz yig'ish uchun ishlatiladigan shablonlar bo'ylab ishlayotgan bo'lsa, primerlarning to'g'ri kombinatsiyasini ishlatishdan ehtiyot bo'ling.
                  • Masalan: bir marta men vektorni kesgan edim va orqa miya uchun astarlarning noto'g'ri kombinatsiyasidan foydalandim. Jelning tasmasi to'g'ri ko'rinardi (5kb orqa miya uchun 400 bp farq juda nozik), lekin ikkita tikuvdan faqat bittasi to'g'ri yig'ilishlarga olib keldi.

                  Tozalash va yig'ish uchun etarli miqdorda qiling

                  • Yig'ish uchun DNKni yaratish uchun tozalash shkalasi reaktsiyalarini bajaring
                    • Agar mahsulotingiz o'ziga xos bo'lsa va uni jel bilan tozalash kerak bo'lmasa: (faqat PCR bilan tozalash kerak)
                      • 20uL kuchli kuchaytirilgan qo'shimchalar juda ko'p. Agar u orqa miya bo'lsa, biroz ko'proq (30uL) qiling. Bu miqdorlar, odatda, 5+ yig'ilishlar uchun ko'p DNK beradi, bu esa bir nechta urinishlarga imkon beradi.
                      • yon mahsulotlarning qanchalik yomonligiga qarab, 60-120 uL ga yaqinroq ishlaydi.

                      PCR parchalarini tozalang

                      • PCR mahsulotlarini tozalashning eng yaxshi usuli - bu oddiy ustunlarni tozalash. Biz Qiagen PCR tozalash to'plamidan foydalanamiz va suvda tozalaymiz.
                        • Bu odatda sizning PCRlaringiz siz xohlagan tarmoqli o'lchamiga juda xos bo'lishini talab qiladi. Shuning uchun PCR primerlari 70 o C haroratda eriydi: yuqori haroratda (67-70 o C) tavlanish-bu sizga kerakli PCR amplifikatsiyasini berishning eng yaxshi usuli. Siz tekshirishingiz kerak
                        • Bu primer dimerlarni va keraksiz chiziqlarni olib tashlaydi. Afsuski, kolonka asosidagi jel ekstrakti to'plamlarining samaradorligi juda past. Siz suvda yoki to'plam tomonidan taqdim etilgan buferda (faqat 10 mM Tris, pH 8,5 va ampda EDTA yo'q deb hisoblasangiz) tozalashingiz mumkin, lekin men har doim suvdan foydalanardim.
                        • Mahsulotni konsentratsiyalash uchun 30 ml (50 ml emas) bilan suyultiring.

                        100 uL PCR mahsuloti odatda hosil beradi

                        Nano Drop PCR fragmentlari

                        • Har bir eluatning DNK kontsentratsiyasini taxmin qilish uchun NanoDrop mashinasida 1,5 ml ishlang.
                        • Mahsulotlarning yaxshi ko'rinishini va tozalash paytida tasodifan aralashmaganligini tasdiqlash uchun siz mashinada ishlaydigan 1,5 l ishlaydigan agaroz jelini ishlatishingiz mumkin.
                        • Misol:

                        Gibson yig'ilish reaktsiyasi

                        • tozalangan PCR mahsulotlaringizni qo'shing va tijorat to'plami yoki uyda pishirish retseptida ko'rsatilganidek, kerakli konsentratsiyaga erishish uchun suv qo'shing.
                          • Savdoda mavjud bo'lgan to'plam ishlaydi

                          Transformatsiya

                          • Odatda elektroporatsiya ishlatiladi, chunki bu sizga ancha yuqori samaradorlikni beradi. Biroq, ba'zi odamlar kimyoviy jihatdan vakolatli hujayralardan foydalanadilar, bu yig'ish oddiyroq bo'lsa, etarli bo'lishi mumkin. Qanchalik DNKni o'zgartirasiz va avval uni tuzsizlantirishingiz kerakmi, siz kutgan yig'ish samaradorligi va mahsulotning toksikligiga bog'liq.
                          • Millipora filtrlarida 15 daqiqa davomida DNKni tuzsizlantirish siz elektroporatsiyalarga ko'proq DNK qo'shishingiz va yoy bo'lmasligini anglatadi.
                            • Biz 12-20 uL reaktsiyalarni tuzatish uchun Millipore tuzsizlantiruvchi qog'ozni, VSWP01300-bandni va katta hajmlar uchun Millipore # VSWP02500 dan foydalanamiz. Butun majmuani suv ustida suzuvchi filtr ustiga qo'ying.
                            • Aaron Puri 15 daqiqa tuzsizlantirishni kutadi va 1,6 kV kuchlanishda yoysiz elektroporatsiya qiladi. -6/2015. Ularni uzoqroq qoldirishning zarari yo'q.

                            • Kimyoviy vakolatli hujayralarga qaraganda ancha samarali bo'lishi mumkin.
                            • Foydalanish

                            • Agar siz tijoriy montaj aralashmasidan foydalansangiz va sizning dizayningiz (a) unchalik murakkab bo'lmasa (juda ko'p bo'lak, yakuniy mahsulotning juda katta qismi, genlarning toksikligi) va (b) juda yaxshi (kontsentrlangan) elektrokompetent hujayralarga aylansa, keyin 1-2 uL sizga maysazorga ega bo'lish uchun etarli koloniyalarni berishi mumkin.
                            • Ba'zilarini o'zgartirishni xohlashingiz mumkin un-haqiqiy transformatsiyaning fonini tushunish uchun bo'laklar yig'ilgan. (Transformatsiya plitasida o'sadigan ba'zi koloniyalar Dpn1 hazm bo'lishiga qaramay, siz xohlagan konstruktsiyaga emas, balki shablonli DNKga ega bo'ladi.
                            • Agar siz ampitsillinga qarshilik ko'rsatadigan plazmidlarni qoplamoqchi bo'lsangiz, ampitsillin emas, balki karbenitsillinga plastinka qo'ying.
                              • Ampitsillin sun'iy yo'ldosh koloniyalarini yoki hatto chidamsiz bakteriyalarning maysalarini berish bilan mashhur. Agar bu sizning plazmidingiz sekin o'sishga olib keladigan bo'lsa, bu ayniqsa muammodir, chunki chidamsiz bakteriyalar gullab-yashnashi uchun ko'p vaqtga ega bo'ladi. Agar sizning elektrokompetent hujayralaringiz yaxshi bo'lsa, u holda hujayraning yuqori zichligi Amp plastinkasida bakteriyalar maysazoriga olib kelishi mumkin, hatto ko'pchilik bakteriyalar Ampga chidamli bo'lmasa ham. Siz elektroporatsiyaning kichik bir qismini Amp-ga qo'yishingiz mumkin, lekin bu sizning yig'ilish samaradorligi yuqori va yuk kam bo'lgan plazmidga ega bo'lishingizni taxmin qiladi (masalan, engil targ'ibotchi + RFP, yuqori quvvatli targ'ibotchi va ko'p fermentlar emas).

                              Tekshiruv: PCR koloniyasi

                              PCR bo'laklarini yaratish uchun koloniyali PCRdan foydalaning, bu sizning yig'ilishingizni tasdiqlaydi.

                              • Buning uchun Phusion -dan foydalanmang, bu juda qimmatli.
                              • Men [2X OneTaq http://www.neb.com/nebecomm/products/productM0486.asp] PCR aralashmasini bir necha sabablarga ko'ra ishlataman:
                                • Bu arzon
                                • Muzlatgichda muzlatgichda, muzlatilgan holda, oylar davomida saqlanishi mumkin.
                                • Unda allaqachon yuklovchi bo'yoq bor, shuning uchun kuzatish uchun agaroz jellariga yuklash tezlashadi.
                                • Maslahat: Oxirgi 1x aralashmasi uchun tegishli nisbatda taxminan 1/2 ml suv va koloniya PCR primerlarini tayyorlang. Aralashtirish nisbatlarini bilish uchun ushbu jadvalga qarang. Davom eting va 1/2 ml tayyorlang, keyin sizda qo'shimcha borligidan xursand bo'lishingiz mumkin va suv/primerlar deyarli bepul. Siz qoldiqlarni muzlatgichda abadiy saqlashingiz mumkin, agar men 212 va 213 primerlarini aralashtirsam, OneTaq 212 213 konini belgilayman. Keyin siz PCR koloniyasini ishlatganda, har bir quduqqa 6 ml bu aralashmani qo'shib, har bir quduqdagi hujayralarni eritib, ustiga 2x aralashmaning 6 ul qo'shing.
                                • Shu bilan bir qatorda, siz 1x aralashmani tayyorlashingiz mumkin (kerakli suv va primerlarni qo'shing) va aralashmani ko'p muzlatish-eritish davrlaridan keyin ishlatishingiz mumkin.
                                • Shablon plazmidlaringizdan farqli uzunlikdagi mintaqada PCR. Bu sizga qaysi biri muvaffaqiyatli yig'ilish va qaysi shablonni o'tkazish ekanligini aniqlash imkonini beradi.
                                  • Agar siz plazmiddagi genni o'zgartirsangiz va gen hajmi boshqacha bo'lsa, ushbu mintaqaning uzunligi uchun PCR.
                                    • Agar siz bo'sh vektorga joylashtirsangiz va sizning andozalaringiz bir xil mahsulot hajmini bermasa, siz butun qo'shimchada PCR qilishingiz mumkin.
                                    • Siz sinovdan o'tgan koloniyalaringizni natijalarini ko'rishdan oldin yoki keyin o'zgartirishga qaror qilishingiz mumkin. Men har doim bir marta dam olaman, bitta koloniya bo'lishni maqsad qilib, mening miniprepim populyatsiyali bo'lish ehtimolini kamaytiradi.
                                      • Men bir vaqtning o'zida tarelka qilaman, agar:
                                        • O'ylaymanki, muvaffaqiyatli bo'lgan fraktsiya (shablon emas) yuqori bo'ladi
                                        • Men bir kecha -kunduzda PCR ishlayapman va natijani ertalabgacha olmayman.
                                        • O'ylaymanki, natijalar asosan shablon plazmididan o'tadi
                                        • Men kunga ketishdan oldin PCR mahsulotlarini jelda ishlatish imkoniyatiga ega bo'laman, bu menga faqat "g'oliblarni" qayta tiklashga imkon beradi.
                                        1. Qancha koloniyalarni ko'rishni xohlayotganingizni hal qiling. Quduqlar raqamlangan va koloniya raqamlariga mos keladigan PCR tasmasini (yoki chiziqlarini) tayyorlang.
                                          1. Men 12 -sonli to'plamdan foydalanaman, chunki agarozli jellarim uchun etarli yo'llar va narvonning ikkita bo'lagi bor. DNK shablonini nazorat qilish uchun siz quduqlardan kamida bittasini ishlatasiz. Agar men shablonni muammoli bo'lishini kutsam yoki genlar zaharli bo'lsa va muvaffaqiyatli yig'ilishlar hujayralarni nosog'lom qilsa, men ko'proq koloniyalar (33-34 gacha) qilaman.
                                          2. Agar siz sinovdan o'tgan har bir koloniyani qayta tiklayotgan bo'lsangiz, hozirdanoq idishlaringizni tayyorlang. Men plastinkani 6 ta pirog tilim shakliga ajrataman.
                                          1. Agar boshida nusxa ko'chirsangiz, pirog bo'laklarini ham shu raqamlar bilan belgilang.
                                          1. Agar siz hozirda koloniyalarga qayta tiklanayotgan bo'lsangiz: plastinkadagi koloniyaning bir qismini arting, so'ngra qolganini tegishli raqamli PCRda yaxshilab eritib yuboring.
                                          2. Agar siz hozirda koloniyalarda dam olmayotgan bo'lsangiz, plastinkada ozgina biomassa qoldirishga harakat qiling, lekin agar siz agarozani teshib qo'ymagan bo'lsangiz, hujayralar doimo qoladi.
                                          3. Agar sizda haqiqatan ham katta koloniyalar bo'lsa va uni ko'p qismini pipetka uchi bilan so'rib olsangiz, uni ortiqcha yuklashingiz mumkin.
                                          4. Berilgan PCR qudug'ida koloniya eriganidan so'ng, pipetka uchini orqasidagi quduqqa chiqarib yuboring. Transformatsiya plastinkasida har bir quduq raqamlangan va koloniyalar raqamlangan va aylantirilgan bo'lishidan tashqari, bu har bir PCR reaktsiyasida faqat bitta koloniya bo'lishini ta'minlash uchun qo'shimcha himoya hisoblanadi.

                                          Ketma-ketlik

                                          • Koloniya PCR asosida tartiblash uchun 2-4 koloniyani tanlang
                                          • Avval Gibson yig'ilishining tikuvlarini ketma-ket joylashtiring.
                                          • Boshqa hududlarni ketma-ket joylashtiring, chunki PCR xatosi kiritilgan bo'lishi mumkin
                                            • Odatda "xato" topilganda, u aslida shablonda mavjud edi.

                                            MacVector 17 bilan Gibson Assambleyasi uchun primerlarni loyihalash

                                            MacVector 17-da ligazadan mustaqil klonlash strategiyalarini avtomatlashtirilgan tarzda loyihalash uchun mutlaqo yangi vosita mavjud. Asbob 5 'ekzonukleaz bilan boshqariladigan Gibson yig'ilishini, shuningdek T4 DNK polimeraza 3 "ekzonukleaz" Ligazaga mustaqil klonlash "yondashuvini qo'llab -quvvatlaydi. MacVector siz ishlatmoqchi bo'laklar va vektorlarni ko'rsatganingizda avtomatik ravishda primerlarni loyihalashtirishi mumkin. Siz maxsus primerlarni berishingiz mumkin (qo'lda yoki NEBuilder veb -sayti kabi asboblardan). Bundan tashqari, MacVector -ning yig'ilishi uchun siz mavjud bo'laklarni bir -birining ustiga yopishib olishingiz mumkin. Interfeys oqsillarning birlashishi doirasini tasdiqlash uchun tegishli CDS tarjimalarini o'z ichiga olgan bo'laklar orasidagi birikmalarning aniq tuzilishini ko'rsatadi. Klonlash strategiyasi yangi klonlash loyiha hujjati sifatida saqlanishi va nihoyat avtomatik ravishda eksport qilish uchun yagona ketma -ketlikda to'planishi mumkin.

                                            MacVector 17 2019-yilning fevral oyida chiqarildi. Unda genomlarni taqqoslash, cheklovchi fermentlarni klonlashni osonlashtirish, Gibson/LIC klonlash strategiyalarini avtomatlashtirilgan loyihalash, yig‘ish muammolarini ta’kidlash, bir nechta ketma-ketlik ma’lumotlar to‘plamini bitta havola bilan solishtirish va plazmid xaritalarini yanada ko‘proq qilish uchun yangi vositalar mavjud. O'zingizning primer bog'lovchi saytlaringizni ko'rsatish orqali chiroyli! Nihoyat, MacVector 17 macOS Mojave -ning qorong'u rejimini qo'llab -quvvatlaydi, bu kechki dizayndagi boshlang'ich sessiyalariga diqqatni jamlashga yordam beradi!


                                            Ishlash ma'lumotlari

                                            NEBuilder HiFi NEB Gibson Assambleyasidan qanday ustunligini ko'ring.

                                            Samaradorlik va aniqlik yaxshilandi

                                            Yaxshilangan sodiqlik

                                            Bu mahsulotlarning bir yoki bir nechtasi New England Biolabs, Inc.ga tegishli yoki boshqariladigan patentlar, savdo belgilari va/yoki mualliflik huquqlari bilan himoyalangan. Ushbu mahsulotlardan foydalanish sizdan ba'zi ilovalar uchun qo'shimcha uchinchi tomon intellektual mulk huquqlarini olishingizni talab qilishi mumkin. .

                                            GIBSON ASSEMBLY & reg - Synthetic Genomics, Inc.ning ro'yxatdan o'tgan savdo belgisi.


                                            Videoni tomosha qiling: Penal mebel yigish uslubi (Avgust 2022).