Ma `lumot

O'simta infiltratsiyali hujayralar normoksiyaga qaytganlaridan keyin gipoksiya tufayli uzoq davom etadigan ta'sirlarni boshdan kechiradimi?


O'simta inflyatsiya qiluvchi limfotsitlar (TIL) yordamida qabul qilingan hujayra ko'chirish (ACT) terapiyasi metastatik melanoma va boshqa ko'rsatmalarni o'z ichiga olgan immuno-onkologik davolanishning eng yuqori pog'onasida turadi (1). Gap shundaki, o'simtaning o'sishi paytida, ba'zi T hujayralari immunitetni o'rnatishga urinishgan, ekstravazatsiyalangan va o'simtaga tushib qolgan, lekin ular haddan tashqari charchab qolishgan. Terapiyaning o'zi bu hujayralarni olib tashlangan o'simtadan olib tashlashni, ularning holatini o'zgartirishni o'z ichiga oladi va ular allaqachon neo-antigenga xos bo'lganligi sababli, bu saratonga hujum qilishga urinib ko'rishadi: ularni kengaytiring, bemorga qaytarib qo'ying, o'simtaga urishiga ruxsat bering. oldingidan ancha qiyin.

Siz nafaqat TILdagi charchoqni qaytarishingiz kerak, balki eng yaxshi javob olish uchun T hujayralarining to'g'ri populyatsiyasiga ega bo'lishingiz kerak. Bunga taalluqli omillar bu savoldan tashqarida, shuning uchun men mavzuga o'taman.

O'simta muhitida T hujayralari tugaydi va ularning ifoda profili o'zgaradi (2). Bu ularni apoptozga ko'proq moyil qiladi va GranzymeB ishlab chiqarish kabi effektor funktsiyalarni yo'qotadi. Bu qanday muammo ekanligini ayta olasiz. Mening shubhalarim shundaki, o'simtada T hujayralari gipoksiyaga aylanishi mumkin va biz bilamizki, kislorodni sezish yo'lida gipoksiyani qo'zg'atuvchi omillar o'z ta'sirini ko'rsatadi. Odatda, agar ular normoksiya ostida ishlab chiqarilsa, oqsillarni inhibe qilish orqali ularni nazorat qilish kerak:

Va mening savolimga:

Uzoq muddatli ta'sir qilishdan keyin gipoksiya, uzoq vaqt qaytgandan keyin tartibga soluvchi yoki transkripsiyaviy o'zgarishlar mavjudmi normoksiya HIF1a yoki HIF2a ni ko'rsatish faol ular odatda qayerda repressiya qilinadi?

Menga yangi ko'zlar kerakmi yoki ma'lumotlar yo'qmi, men buni aniq topa olmadim. O2 normal holatga qaytgandan so'ng, mTORC1/2 kabi yo'llarga ta'sir qiladigan, qolgan gipoksiyaga o'xshash tartibga solish tizimi mavjudmi yoki yo'qligini bilmoqchiman. Har qanday tushuncha uchun oldindan rahmat!


Gipoksiyaga yurak-qon tomir moslashuvi va periferik qarshilikning roli

Umurtqali hayvonlarda tizimli qon tomir bosimi bir qator omillar bilan tartibga solinadi: nazorat qilishning asosiy elementlaridan biri to'qimalarning kapillyar yotoqlarida periferik qarshilikdir. Qon tomir oqimining markaziy nazorati va periferik qarshilik o'rtasidagi munosabatlarning ko'p jihatlari noaniq. Bunga alohida to'qimalarda gipoksiya reaktsiyasi o'rtasidagi bog'liqlik va reaktsiyaning kislorod etishmovchiligiga tizimli yurak-qon tomir moslashuviga ta'siri muhim misoldir. Biz bu erda bitta katta tomir to'shagida HIF transkripsiya omillari orqali gipoksiya reaktsiyasi, teri ostidagi sichqonlarda gipoksiyaga yurak-qon tomir reaktsiyasi qanday ta'sir qilishini ko'rsatamiz. Biz shuni ko'rsatadiki, terining gipoksiya reaktsiyasi yurak -qon tomir parametrlari, shu jumladan yurak urish tezligi, arterial bosim va tana harorati bilan bog'liq. Ushbu ma'lumotlar periferik to'qimalarda kislorodni sezishning dinamik rolining birinchi namoyishi bo'lib, gipoksiya muammosiga yurak-qon tomir reaktsiyasini bevosita o'zgartiradi.


O'simta gipoksiyasini ta'riflash

Normoksiya va fitoksiya

O'simta gipoksiyasi bo'yicha ko'plab tadqiqotlarga qaramay, "normoksiya" va "gipoksiya" atamalarini qo'llashda sezilarli chalkashliklar mavjud. Oddiy to'qimalarda kislorod bilan ta'minlash o'lchovlari ular to'qimalarda farq qiluvchi aniq normal diapazonlarni ko'rsatishini ko'rsatadi (1-jadval). "Normoksi" deyarli hamma joyda to'qima kulturasidagi kislorodning "normal" darajasini tasvirlash uchun ishlatiladi. ya'ni taxminan 20-21% kislorod (160 mm simob ustuni). Garchi bu aniq bo'lmasa-da, chunki u balandlik va qo'shilgan CO ga bog'liq2, ko'p holatlar uchun 20% yaxshi taxminiy hisoblanadi. "Normoksiya" ning keng qo'llanilishiga qaramay, bu periferik to'qimalarni kislorod bilan ta'minlash uchun aniq taqqoslash emas. Hatto o'pka alveolalarida ham suv bug'lari va muddati o'tgan CO borligi tufayli kislorod darajasi taxminan 14,5% kislorodga (110 mmHg) kamayadi.2. 13 U arterial qonda yanada pasayadi va periferik to'qimalarga yetib borgach, kislorodning o'rtacha darajasi 3,4% dan 6,8% gacha, o'rtacha 6,1% ni tashkil qiladi (2-jadval). 13

Jadval 1. Oddiy to'qimalar va o'smalarda kislorodning taxminiy darajasi

a To'qimalar darajasi haqida aniq raqamlarni qo'yish mumkin emas. Taqdim etilgan qiymatlar bir necha manbalardan olingan qo'llanma hisoblanadi (shuningdek, 2 -jadvalga qarang).

b Gipoksiyaga normal fiziologik reaktsiyalar taxminan 15 mmHg (2% kislorod) dan yuqori bo'ladi. Oddiy to'qimalar bundan past bo'lmasligi kerak, chunki gomeostaz kislorod miqdorini fizoksiyaga qaytarishga intiladi. Gipoksiyaga javob beradigan genlarning regulyatsiyasi uchun kislorodning aniq darajasi ma'lum emas, u har xil to'qimalar/hujayralar turlicha bo'lishi mumkin, chunki normal to'qimalarda kislorodning o'rtacha darajasi har xil.

cPatologik gipoksiyaning mavjudligi, to'qimaning yana fiziksiyaga qayta olmaganligini ko'rsatadi. Oddiy to'qimalarda kislorodning pastligi to'qimalarning nekroziga olib keladi, bu esa muhim funktsional oqibatlarga olib kelishi mumkin. Shishlarda ham bu sodir bo'lishi mumkin. O'simta g'ayritabiiy o'sish bo'lganligi sababli, nekroz tufayli to'qimalarning yo'qolishi ma'lum funktsional ahamiyatga ega emas. Biroq, gipoksiyaga chidamli o'simta hujayralari oxir-oqibat jim bo'lib qoladi, gipoksiyaga chidamli, o'ta xavfli o'simta hujayralari uchun tanlov bo'ladi.

Jadval 2. Kislorodning qisman bosimining hisoblangan qiymatlari haqida qisqacha ma'lumot (pO2) inson o'smalari va ular bilan bog'liq oddiy to'qimalarda

n, bemorlar soni SH, aniqlanmagan.

Jadvalga kiritilgan ma'lumotlar, birinchi navbatda, Vaupel va boshqalar tomonidan o'tkazilgan meta-tahlilning xulosasi. 5 Har bir o'simta turi uchun kiritilgan tadqiqotlar soni "o'simta turi" ustunidagi raqam bilan ko'rsatiladi. Boshqa ma'lumotlar, havola qilinganidek, bitta tadqiqotlardan olingan. To'qimalarning normal kislorod bilan to'yinganligi uchun o'rtacha "o'rtacha" ko'rsatkichlar faqat ikkita qiymat o'rtasidagi tafovutni ko'rsatish uchun berilgan. Bu diapazon juda katta va o'smalarning turli xil to'qimalarining kelib chiqishini aks ettiradi, ammo normal to'qima ma'lumotlari bilan bir -biriga o'xshashligi juda cheklangan. (O'rtachalar har bir guruhdagi qiymatlar sonini hisobga olgan holda hisoblab chiqilgan.)

o'simtaning bir marta kamayishi va boshqalar Oddiy to'qima jadvalda keltirilgan barcha ma'lumotlarga asoslanadi (prostata bezidan tashqari, qo'shimcha ma'lumotlarga qarang).

b Qatlamning qisqarishi psoas mushagida bir vaqtda o'lchovlar bo'yicha hisoblanadi.

Ikki siydik pufagi saratoni bilan og'rigan bemorlarning "normal" prostata qiymatini o'z ichiga olgan uchuvchi tadqiqotdan olingan cMa'lumotlar.

Bu "normoksiya" atamasining anomaliyasini aniq ko'rsatib beradi. Oddiy periferik to'qimalarga kislorod miqdori ilhomlangan havodan taxminan 75% past bo'lganligi sababli, 5% kislorod (38 mm simob ustuni) to'qimalarning kislorodlanishini aniqroq taxmin qilishini va buni "fiziksiya" deb e'tirof etish kerak, boshqa eksperimental shartlarni solishtirish kerak. Tadqiqotchilar pH, glyukoza va boshqalar kabi boshqa parametrlar uchun bunday noto'g'ri qiymatni qabul qilmaydilar, ammo ajablanarlisi shundaki, ular ko'p yillar davomida zaharli ekanligi ma'lum bo'lgan kislorodni nazorat qilish muhimligini e'tiborsiz qoldiradilar. 34 Shuni ta'kidlash kerakki, ma'lum bir gazli aralashmada madaniy muhitning kislorod darajasiga tenglashishi 3 soatgacha davom etishi mumkin. kislorod o'tkazuvchan kulturalarda etishtiriladi (www.coylab.com). Kislorod % mmHg dan ko‘ra fiziologik jihatdan mazmunliroq bo‘lganligi sababli, % kislorod kislorod miqdori haqida hisobot berish uchun yaxshiroq birlik ekanligi taklif qilinadi, chunki u ko‘plab to‘qimalarda kislorodning nisbatan past, ammo aniq normal darajasini ko‘rsatadi, shuningdek, ayniqsa past darajalarni yaxshiroq ta’kidlaydi. o'smalarda topilgan kislorod. (Eslatma: gaz bosimi uchun SI birligi kpaskal, tasodifan 100% kislorod 101,3 kpaskalga teng, shuning uchun bu birliklar son jihatdan deyarli ekvivalentdir.)

Fizoksiyaning pastki chegarasi taxminan 3% kislorod (23 mmHg) ni tashkil qiladi (1-jadval). Gomeostaz fiziologik parametrlarni chegaralangan kislorodli o'rtacha to'qimalarga ega bo'lgan chegaralarda saqlaydi (2 -jadvalga qarang: Carreau va boshq. 13). Bu xilma -xillik har xil kelib chiqadigan hujayralar kislorodga sezuvchanligi turlicha ekanligini ko'rsatadi va oddiy to'qimalarda kislorodni pasaytirishga bir qator tolerantliklar ham borligi ma'lum. Miya to'qimasi ayniqsa sezgir va etarli kislorodsiz atigi 3 daqiqa yashay oladi, boshqa to'qimalar esa ancha bardoshli, masalan buyrak va jigar (15-20 min), skelet mushaklari (60-90 min), tomirlarning silliq mushaklari (24-72 soat) va soch va tirnoqlar (bir necha kun). 36

Fiziologik gipoksiya

Keyinchalik "fiziologik gipoksiya" to'qimalarning o'zlarining afzal ko'rgan kislorod darajasini saqlab qolish uchun javob beradigan kislorod darajasi sifatida aniqlanishi mumkin. Bu fiziologik usulda bo'lishi mumkin. masalan vazodilatatsiya, qon oqimining oshishi va/yoki gipoksiyaga javob beruvchi genlarning regulyatsiyasi. 12 Fizoksiya individual to'qimalar uchun farq qilganligi sababli, ularda turli xil gipoksik qo'zg'atuvchi nuqtalar bo'lishi mumkin, buning ostida bu sodir bo'ladi. Oddiy to'qimalarda bu o'tkinchi bo'ladi, ammo to'qimalarni kerakli kislorod darajasiga qaytarish uchun etarli. Oddiy to'qimalar odatda 3-7% kislorodda saqlanganligi sababli, fiziologik gipoksiya 2-6% kislorod oralig'ida bo'lishi mumkin. Bu shuni ko'rsatadiki, gipoksiya reaktsiyasi elementlari turli to'qimalarda turli kislorod darajalarida yaxshi tartibga solinishi mumkin. Hozirgi vaqtda "fiziologik gipoksiyani" qanday o'lchash mumkinligini tasavvur qilish qiyin, chunki gomeostaz uni darhol qaytarish uchun ishlashi kerak, shuning uchun har qanday ko'rinish o'tkinchi bo'ladi. Bu bir qator o'zgarishlar, jumladan, perfuziyani oshirish va gipoksiya induksiyali omil (HIF) ning vaqtincha barqarorlashishi, shu bilan birga tuzatishlar amalga oshiriladi. 37 HIF1a va HIF1b ifodasi madaniyatli HeLa hujayralarida 0% dan 20% kislorodgacha o'lchanganda, maksimal javob 0,5% kislorodda, 1,5-2% kislorod ifodasida yarim maksimal ifoda 4% kisloroddan sezilarli darajada past edi, 38 HIF1 kislorod etishmasligiga fiziologik javoblarni nazorat qilish uchun zarur diapazonda faol ekanligini tasdiqlaydi (quyida muhokama qilinadi).

Patologik gipoksiya

"Fiziologik gipoksiyaning" taxminiy diapazonini aniqlab, bu patologiyada mavjud bo'lgan kislorod miqdorini aniqlashga yordam beradi. Haqiqatan ham, savol tug'iladi: nega patologik to'qimalarda gomeostatik mexanizmlar kislorod miqdorining pasayishiga teskari ta'sir ko'rsatmaydi? Surunkali bo'lishi mumkin bo'lgan ishemik kasallikda (masalan diabet, o'pka funktsiyasining pasayishi va boshqalar) yoki o'tkir (masalan qon tomirlari, koronar arteriya okklyuziyasi va boshqalar), to'qimalarni oziqlantiruvchi tomirlarning oqimi yo'qolishi/okklyuziyasi tufayli gomeostazni qayta tiklash mumkin bo'lmasligi mumkin. Ammo o'smalarda tez -tez angiogenez kuchayadi, ammo kislorod darajasi (davolanmagan o'smalarda ham) ancha past bo'ladi, 0,3% dan 4,2% gacha kislorod (2–32 mm simob ustuni), deyarli hammasi 2% dan past bo'ladi (2 -jadval). Umuman olganda, o'simta tomirlari xaotik bo'lib, uchlari ko'r, shuntlari va yiqilish tendentsiyasiga ega bo'lgan oqadigan tomirlardan iborat ekanligi e'tirof etiladi. Ko'rinib turibdiki, qon tomirlari kislorod darajasini qo'shni normal to'qimalardan ancha past darajada ushlab tura olmaydi (2-jadval), ko'p holatlarda HIF1 regulyatsiyalanganligini isbotlaydi. 40

Shu sababli, o'smalar doimiy ravishda kislorod yetishmaydigan o'simta mikro-muhitida (TME) o'sishi va kengayishiga yaxshi moslashgani aniq. "Patologik gipoksiyani" aniqlashda hech qanday aniqlik yo'q, lekin haqiqat shundaki, hamma o'smalarda kislorodning o'rtacha darajasi 2% ga etadi va bu ko'rsatkich bo'yicha individual o'lchovlar taxminan 6% dan (kamdan -kam hollarda) nolgacha o'zgarishi mumkin. tez -tez bu diapazonning pastki chetiga qarab sezilarli darajada burilish, aksariyat qiymatlar kislorodning 1,3% dan (10 mm simob ustuni) past, ayniqsa gipoksik o'smalarda. Ushbu gauss bo'lmagan taqsimotning ko'plab misollari 2-jadvalda keltirilgan nashrlarda keltirilgan.

Shishlarda gomeostatik jarayonlar ikkita asosiy sababga ko'ra buzilgan ko'rinadi. Birinchidan, qon tomirlari juda yomon sifatga ega va o'sayotgan o'simtani kislorod bilan etarli darajada va ishonchli ta'minlay olmaydi. Darhaqiqat, agar o'simta hujayralari kislorodga sezgir bo'lsa, kislorod miqdori etarli emasligi sababli o'ladi. Bu boshqa asosiy sababga olib keladi: aniqki, o'simta hujayralari o'lmaydi, bu ularning katta qismi sezilarli darajada gipoksiyaga chidamli ekanligini ko'rsatadi. Qisman, bu ularning energiya ehtiyojlarining ko'pini qondirish uchun glikolizga o'tishi bilan bog'liq bo'lishi mumkin, bu ko'p yillar oldin Warburg tomonidan aniqlangan o'smalarning o'ziga xos xususiyati. 41 Bundan tashqari, uzoq davom etadigan patologik gipoksiyaga ta'sir qilish stressga chidamli va xavfli bo'lgan gipoksiyaga chidamli o'sma hujayralarini tanlaydi (pastga qarang). Bu sodir bo'lgan kislorodning aniq darajasi haqida aniq ma'lumot berish qiyin, ammo u deyarli <1% kislorod (7,5 mmHg) va sezilarli darajada past bo'lishi mumkin. Shunisi e'tiborga loyiqki, o'simta hujayralari sezilarli darajada past kislorod darajasiga qanchalik moslashadi. Bir tadqiqotda, gipoksiya 24 soat davomida kislorod darajasi 0,01% dan (0,075 mmHg) past bo'lganida o'simta hujayralarining o'limiga sabab bo'lgan. 42 Tadqiqotlarimizda LNCaP o'simta hujayralarining bir qismi ta'sirdan omon qoldi in vitro 0,1% kislorod bilan 48 soat yoki undan ko'p. 43 Yaqinda biz bikalutamid bilan ishlangan prostata prostata ksenograftsining kislorodining o'rtacha darajasi 10 kundan ko'proq vaqt davomida 0,1% kisloroddan pastda qolganini ko'rsatdik. 44 Umuman olganda, bu haddan tashqari stressda omon qolish Darvincha selektsiya jarayoni bilan boshqariladigan xavfli fenotiplar uchun tanlovga olib keladi. 45

O'simtaning kislorodlanishining o'zgaruvchanligi

Odatda o'smaning kislorod bilan to'yinganligi o'rtacha qiymat sifatida ko'rsatiladi, ammo individual o'smalarda sezilarli heterojenlik mavjud. 5 Bundan tashqari, mikroregional kislorodlanish barqaror emas va kislorod darajasi o'simta ichida mahalliy qon tomirlarining funksionalligi va yaqinligiga qarab o'zgarib turadi. 46 Darhaqiqat, kalamush o'smalarida kislorodning ba'zi o'zgarishi qizil hujayralar oqimining o'zgarishi bilan bog'liq bo'lishi mumkinligi ko'rsatilgan. 47 Ishlayotgan kapillyarlar atrofidagi "yaxshiroq kislorodli" o'simta hujayralari ozgina kislorod oladi, lekin kamdan-kam hollarda oddiy hujayralarnikiga o'xshaydi (2-jadval). Hujayralarning bo'linishi va o'simtaning o'sishiga ruxsat berish kifoya, bu deyarli glikolizning yuqorida aytib o'tilgan darajasi bilan kuchayadi. 41 Darhaqiqat, bu mitoxondriyal faollikning pasayishi bilan ham yordam berishi mumkin. 48 Hujayralar bo'linib, kapillyarlardan uzoqlashganda, ular kamroq kislorod oladi va ko'proq distal hujayralar surunkali gipoksiyaga uchraydi 49, oxir-oqibat, hujayralar nobud bo'ladi va to'qimalar nekrotik bo'ladi. Gistologik bo'limlarda yashovchan hujayralar ko'pincha taxminan 150 mkm gacha bo'lgan qon tomirlari atrofida faol o'sadigan hujayralarning "kordonlari" sifatida ko'riladi, garchi bu masofa 70 dan 200 mkm gacha bo'lgan boshqa o'zgaruvchidir. 2,47,50,51 O'zgaruvchanlik, ehtimol, ikkita asosiy omil bilan bog'liq: (i) ma'lum bir o'simta hujayrasi turining kislorodga bo'lgan ehtiyoji va (ii) uning gipoksiya bardoshliligi. Hujayralar qanchalik metabolik faol bo'lsa, o'simta simlari kichik bo'ladi. Hujayralar patologik gipoksik holatga kelgach, bu fraktsiyadagi hujayralar ulushi ularning gipoksiyaga bardoshliligiga bog'liq bo'ladi. Ular qanchalik bardoshli bo'lsa, ular shunchalik uzoq vaqt jim bo'lib qoladilar, lekin hali ham hayotiy bo'lib qoladilar, natijada kattaroq gipoksik fraktsiyaga ega bo'lgan proportsional ravishda ko'proq gipoksik shish paydo bo'ladi. Aksincha, gipoksiyaga sezgir o'simta hujayralari tezroq o'ladi, shuning uchun gipoksik fraktsiya kichikroq bo'ladi.

Bundan tashqari, qon tomirlari etarli bo'lmaganligi va limfa drenajlanishi deyarli bo'lmaganligi sababli, interstitsial bosim o'zgarib turadi, bu esa vaqti-vaqti bilan tomirlarning qulashiga olib keladi. Yiqilgan qon tomirlari atrofidagi hujayralar qancha vaqt davom etishi "keskin gipoksik" bo'lib qoladi, lekin hayvonlarning o'smalarida 20 daqiqadan bir necha soatgacha bo'lganligi ko'rsatilgan. 52,53 Shubhasiz, bu dinamik holat va yana keltirilgan raqamlarga qaraganda ancha uzunroq va qisqaroq bo'lishi mumkin, chunki bu raqamlar nashr etilgan tadqiqotlarda tanlangan vaqtga to'g'ri keladi (Bayer va Vaupel 54 tomonidan ko'rib chiqilgan). Bu bo'linmadagi hujayralar (agar ular o'lmasa) hali ham tsiklda bo'lishi mumkin, ayniqsa o'tkir gipoksiya qisqa bo'lsa. Ular o'simtani "surunkali gipoksik" tinch hujayralarga qaraganda tezroq ko'paytirishga qodir bo'ladi. Ammo, agar ular ta'sir qilish davrida tomirlar yopiq bo'lsa, ular RT (kislorod etishmasligi tufayli) yoki CCT (etkazib berish etishmasligi tufayli) dan himoyalangan bo'ladi. Gipoksik hujayralar xavfli o'sishga ko'proq hissa qo'shishi mumkinligini ko'rsatadigan ba'zi dalillar mavjud. 54–56

Shunday qilib, o'simtaning kislorodlanishi ko'rsatkichlaridagi o'zgarishlarni kutish kerak, individual ko'rsatkichlar asosan patologik diapazonda bo'lgan kislorod darajasida bo'lsa ham, o'simta bo'ylab farq qiladi. 46 Klinik tadkikotlarda, turli xil tadqiqotlarning har xil o'simtalaridagi o'rtacha darajalari har doim ham bo'lmasa ham o'xshash (2 -jadval). Bu o'lchovlar haqiqiy ekanligiga ishonch hosil qiladi va medianlar individual ko'rsatkichlarning sezilarli tarqalishiga asoslangan bo'lsa-da, o'simta massasidagi median kislorodlanishning haqiqiy ko'rsatkichini beradi. LNCaP ksenograflarida biz transport vositasida davolangan o'smalarda kislorodning o'rtacha darajasi sezilarli darajada takrorlanuvchanligini aniqladik (quyida muhokama qilinadi). 44 Odamlarda, normal ko'krak to'qimasida kislorodning o'rtacha darajasi qondagi gemoglobin darajasidan qat'i nazar, doimiy ravishda o'zgarib turishi isbotlangan. Bu ko'krak o'smalaridan farqli o'laroq, pO ning sezilarli darajada pastligini ko'rsatdi2 Oddiy to'qimalarga qaraganda, shuningdek, pasayish, bu past darajada, chunki gemoglobin kontsentratsiyasi pasayadi. 57

O'simta gipoksiyasi va malign rivojlanishi

Gipoksiyaning ko'pgina genetik o'zgarishlarni keltirib chiqarishi aniq, lekin faqat HIF1 va HIF2 vositachiligida emas. 40 Yuqorida muhokama qilinganidek, normal hujayralarda HIF1 ifodasi to'qimalarning kislorodlanishini normal chegaralarda ushlab turish bilan shug'ullanadi. Uning javobi deyarli bir zumda ishlab chiqilgan, chunki HIF1 faol transkripsiya faktori HIF1b va beqaror HIF1a oqsilidan iborat. Ikkinchisi doimiy ravishda ishlab chiqariladi va parchalanadi, shu bilan uning darajasi fosoksik hujayralarda sezilarli darajada past bo'ladi. Kislorod darajasi tushishi bilan HIF1a ning chiqarilishi inhibe qilinadi, bu esa HIF1 kompleksining shakllanishiga imkon beradi, bu darhol ko'p hujayrali o'zgarishlarga olib keladi, bu esa normal hujayralarda fizik holatga qaytishga olib keladi. 37,58 Ammo, o'smalarda, kislorod darajasidan qat'i nazar, HIF1 ifodasi davom etaveradi, bu shuni ko'rsatadiki, o'simta hujayralarida kislorodga qaramligini kamaytiradigan adaptiv reaktsiya mavjud. Ba'zi o'simta hujayralarida bu HIF ifodasining konstitutsiyaviy o'zgarishi bo'lishi mumkin, boshqalarda esa, bu normal hujayralardagi HIF ifodasini yaqindan nazorat qiluvchi oqsillarning bir yoki bir nechta kompleksiga genetik o'zgarish natijasida kelib chiqadi. 37,58 Bu oddiy (fitoksik) hujayralardan juda farq qiladigan fenotipni o'rnatadi. Afzallik bilan, moslashtirilgan o'simta hujayralari kislorodga bo'lgan ehtiyojni kamaytiradi, bu esa gipoksik sharoitda omon qolish qobiliyatini sezilarli darajada yaxshilaydi, bu esa ularning energiya ehtiyojlarini qondirish uchun glikolizdan foydalanish qobiliyati bilan bog'liq. 41,48

HIF1 bilan tartibga solinadigan fenotipga o'tish yuzlab genlar uchun tanlovga yordam beradi, ularning aksariyati yanada xavfli fenotip bilan bog'liq. Masalan, tomirlarning endotelial o'sish omili (VEGF) va interleykin 8 (IL8) kabi genlar regulyatsiyasi bilan yanada angiogen fenotipga o'tish mavjud, angiogenez inhibitörleri esa past regulyatsiya qilingan, masalan angiostatin va endostatin. Ushbu gipoksik reaktsiyaga aloqador bo'lgan boshqa genlar/yo'llar yadro omili KB, faollashtiruvchi protein-1, sutemizuvchilarning rapamisin kinaz maqsadi va ochilgan oqsil reaktsiyasini o'z ichiga oladi. 59-61 Garchi bu genlar/yo'llar mustaqil ravishda faollashsa, kislorodga sezgir yo'llarning ko'payishini ko'rsatsa ham, ular gipoksiyaga kompleks tarzda javob berishi mumkinligi haqida dalillar mavjud. 62

Dastlabki tadqiqotlar shuni ko'rsatdiki, gipoksiya apoptoz nuqsonlari bo'lgan hujayralar uchun tanlanadi. 6 Keyingi hisobotlar gipoksiya klonal variantni kengaytirish imkonini beruvchi tanlov bosimini keltirib chiqarishi mumkinligini tasdiqladi in vitro 43,63,64 va in vivo. 55 Laboratoriyamizdagi tadqiqotlar shuni ko'rsatdiki, bikalutamid bilan qo'zg'atilgan gipoksiyaga duchor bo'lgan LNCaP ksenograftlari bo'lgan sichqonlarda o'pkada metastaz kuchaygan, bu Bcl2 ning ko'payishi va Baxning kamayishi bilan bog'liq. 44 Shuningdek, kemiruvchilar o'simta hujayralarida genlarning ko'payishi qayd etilgan ex vivo yoki in vivo gipoksiya uchun bu metastazlarning ko'payishi bilan bog'liq edi. 65,66 To'qimachilik madaniyatida ham, hayvonlar modellarida ham o'tkir gipoksiya/reoksigenatsiyalanish DNK zanjirining uzilishi bilan bog'liq va aniqki, agar bu tanaffuslar tuzatilmasa, ular keyingi mutatsiyalarga olib keladi. Darhaqiqat, o'smalarda DNKni tiklash jarayonlari gipoksiya tufayli ham o'zgaradi va bu irsiy beqarorlikning oshishi bilan bog'liq. 67

Boshqa tadqiqotlar shuni ko'rsatdiki, gipoksiya metastaz bilan bog'liq genlarni, masalan, osteopontin, lizil oksidaza, CXCR4, IL8 va VEGF va boshqa ko'plab boshqa genlarni, birinchi navbatda, HIF1ni barqarorlashtirish orqali tartibga solish orqali malign progressiyani/metastazni kuchaytirishi mumkin. 68-70 Bu p53 inhibitori bo'lgan MDM2 ning ko'payishi bilan ham bog'liq bo'lishi mumkin in vivo bu apoptoz qarshiligiga va metastaz shakllanishining oshishiga olib keladi. 71,72 Yaqinda radiatsiya bilan davolash HIF1 ni haddan tashqari oshiruvchi o'simta hujayralarini ham tanlashi mumkinligi ko'rsatildi. Nurlanishdan keyin, in vivo HIF1 ni haddan tashqari ifoda etuvchi hujayralar o'simta qon tomirlariga ko'chiriladi, HIF1 inhibisyonu bu ta'sirni bloklaydi va o'simtaning qayta o'sishini kamaytiradi. 73

Gipoksiyaga javoban bildirilgan barcha genetik o'zgarishlarni muhokama qilish mumkin emas (batafsilroq ko'rib chiqish uchun 59,74-76 ga qarang). Biroq, izohga muhtoj bo'lgan bir masala bor. Gipoksiyadan kelib chiqqan genetik o'zgarishlar ko'pincha o'lchanadi in vitro va "normoksiya" bilan solishtirganda. Bu, odatda, 5% CO bo'lgan havo deb ta'riflanadi yoki aniqlanmagan bo'lsa kerak2 (ya'ni taxminan 20% O2) ajablanarlisi shundaki, bu taxminning to'g'riligi haqida hech qanday izoh topish kamdan-kam uchraydi. Ammo, yuqorida muhokama qilinganidek, agar nazorat hujayralari fitoksiyada saqlansa, bu normal to'qima uchun muhimroq bo'ladi. ya'ni 5% O2, va fiziologik gipoksiya (1-3%) va patologik gipoksiya (0,5-0,1%) bilan solishtirganda. (Bu raqamlar diapazon sifatida berilgan, chunki ma'lum bir tadqiqotga tegishli bo'lgan kislorod darajasi o'smaning kelib chiqishi va normal to'qimalarga bog'liq bo'ladi. Tegishli qiymatlar uchun 2 -jadvalga qarang.) Ammo genetikada kislorod darajasi kamdan -kam hisobga olinadi. tadqiqotlar in vitro, garchi bu butun to'qimalarda yoki o'smalarda sodir bo'lishini aniq belgilash va solishtirish uchun juda muhim bo'lishi mumkin.

O'zaro bog'liqlikning yo'qligi in vitro hujayralar va qattiq o'smalar inson prostata o'simtasi biopsiyalarida yuzlab androgen retseptorlari bilan bog'lanish joylarini (ARBS) aniqlagan yaqinda o'tkazilgan tadqiqotda tasdiqlangan. Bu ARBSlarning ko'pchiligi o'sgan LNCaP prostata o'simta hujayralarida aniqlanmagan in vitro ammo, ko'plari androgensiz (kastratsiyalangan) sichqonlarda ksenografts sifatida o'stirilgan o'sha hujayralarda topilgan. Inson biopsiyasidan 16 genli imzo to'plami aniqlandi, bu madaniyatli hujayralardan olingan kattaroq imzodan ustun edi, u xenograflangan LNCaP o'smalarida aniqlangan, lekin o'sgan LNCaP hujayralarida emas. in vitro, TME prostata o'smalarida androgen retseptorlari signalizatsiyasini nazorat qilishda katta ta'sir ko'rsatadi. 77 Bu yana ma'lumotlarni taqqoslashda ehtiyot bo'lish kerakligini ta'kidlaydi in vitro tadqiqotlar, ayniqsa hujayralar "normoksiyada" o'stirilganda.

O'simta mikromuhitida kislorod gomeostazi va davolashga javob

Nima uchun gomeostatik mexanizmlar o'smalarda kislorod gomeostazini tiklashga javob bermaydi? Ko'rinib turibdiki, angiogenez rag'batlantiriladi, lekin ko'plab o'smalarda kapillyarlarning keng shakllanishiga qaramay, kislorodni fitoksik darajada ushlab turish uchun hosil bo'lgan qon tomirlari etarli emas. Agar, uzoq davom etadigan gipoksik stressga javoban, o'simta hujayralari pro-angiogen omillarning yanada kuchaygan darajasini ishlab chiqarishga moslashsa/mutatsiyaga uchrasa, ular o'simtaning omon qolish ustunligini ta'minlaydi. Pro-angiogen omillar kritik darajaga yetganidan so'ng, qon tomirlari yaxshilanadi (ehtimol normallashadi) 78 va o'simta o'sadi. Afsuski, bu sodir bo'lganda, u pro-angiogenik, gipoksiyaga chidamli, ko'proq xatarli o'simta hujayralari bilan to'ldirilishi mumkin.

LNCaP o'smalari bo'lgan sichqonlar har kuni mahalliy rivojlangan prostata saratonida keng qo'llaniladigan bikalutamid preparati bilan davolanganda aynan shunday bo'ldi. Ishlov berilmagan LNCaP ksenograftlari yomon kislorod bilan ta'minlangan (0,8% kislorod 6 mmHg), bu klinik tadqiqotlarda topilgan kislorod darajasiga o'xshash edi (0,9% kislorod, 7 mmHg 2-jadval). Sichqonlar har kuni 28 kun davomida bikalutamid bilan davolanganda, kislorod darajasi 1-3 kun ichida ≤0,1% kislorodgacha pasayib ketdi, bu chuqur gipoksiya 10 kundan ortiq davom etdi. Biroq, keyingi 10 kun ichida kislorod miqdori ortib, deyarli davolashdan oldingi darajaga qaytdi. Shishlar o'sib chiqqanda in vivo deraza kameralarida bikututamid bilan davolashning birinchi 14 kunida qon tomirlarining sezilarli darajada yo'qolishi kuzatildi, so'ngra angiogen portlash sodir bo'ldi. Bu o'ziga xos ikki fazali reaktsiya angiogen omillar, shu jumladan VEGF va IL8 ning sezilarli darajada pasayishi bilan bog'liq. Shubhasiz, o'simta hujayralari chuqur gipoksik tahqirlash ta'siridan omon qolishi mumkin va androgen blokadasiga qaramay, o'sishni inhibe qilish neovaskulyarizatsiyani rag'batlantirish uchun etarlicha pro-angiogen omillarni ishlab chiqarish bilan yakunlandi. O'simta hujayralari ushbu muhim omillarni sintez qilish uchun cheklangan energiya ta'minotidan foydalanishga o'tishga muvaffaq bo'ldi. 28 kunlik davolanishdan so'ng, olib tashlangan o'simta hujayralari transport vositasi bilan ishlangan sichqonchadan chiqarilgan o'sma hujayralariga qaraganda, ko'proq invaziv va dosetakselga chidamli edi. Bundan tashqari, bikalutamid bilan davolash qilingan sichqonlarda o'pkaga metastatik tarqalishning sezilarli o'sishi kuzatildi, garchi buni 7-kuni banoksantronning (AQ4N) bir dozasi bilan davolash orqali muvaffaqiyatli blokirovka qilish mumkin, bu ayniqsa gipoksik hujayralarni maqsad qilib olgan. 44

Anti-androgen bikalutamidning dastlabki antivaskulyar ta'siri keng e'tirof etilmaydi, garchi oldingi tadqiqotlar, asosan, kastratsiya modellaridan foydalangan holda, uning paydo bo'lishi ehtimoli haqida ko'plab dalillar keltirgan (44 da muhokama qilingan). Tadqiqotlarimiz shuni ko'rsatdiki, prostata o'simtasi hujayralari gipoksiyaga juda chidamli. Boshqa o'sma turlarida bu biroz farq qilishi mumkin, ammo shuni ta'kidlash kerakki, oshqozon osti bezi o'simta hujayralari gipoksiyaga chidamli bo'lishi mumkin, chunki ular kislorod darajasidan past pankreatik to'qimalarga qaraganda 19 baravar past tirik qoladi (2-jadval). 23 Bemordan olingan ksenograftlar yalang'och sichqonlarda ortotopik tarzda o'rnatilganda, EF5 gipoksik marker yordamida o'lchangan gipoksiya darajasi agressiv o'sish va spontan metastaz uchun prognoz qilingan. 79 Odamning oshqozon osti bezi o'smalari ayniqsa davolashga chidamli bo'lib, bu xususiyat ularning keng stromasi bilan bog'liq. 80 Davolanishga chidamlilik normal oshqozon osti bezidagi kislorod darajasidan ancha past bo'lgan va shuning uchun ayniqsa xavfli fenotipga ega bo'lgan hujayralar tanlanishi natijasida paydo bo'lishi mumkin, deb taxmin qilish jozibali.

Agar gipoksiyaga olib keladigan dorilarga ta'sir qilish gipoksiyaga chidamli/ko'proq xavfli o'simta hujayralarini tanlashi mumkin bo'lsa, kuchaygan va uzoq muddatli gipoksiyaga olib keladigan har qanday davolash xuddi shu narsani qilishi mumkin. Bu bitta agent sifatida ishlatiladigan tomirlarga mo'ljallangan dorilar dastlab kutilganidek muvaffaqiyatsiz bo'lishining asosiy sababi bo'lishi mumkin. Darhaqiqat, angiogen yo'llarning sezilarli darajada ko'payib ketishi kuzatildi va dastlabki antivaskulyar javoblardan so'ng revaskulyarizatsiya aniqlandi (81 -qarang). Aksariyat saratonga qarshi muolajalar (i) to'g'ridan -to'g'ri qon tomirlarini nishonga oladi yoki (ii) o'simta tomirlarining ishlashini qo'llab -quvvatlaydigan o'simta hujayralarini nishonga oladi. Shu sababli, ko'plab davolanishlar erta (ko'pincha tanib bo'lmaydigan) antivaskulyar ta'sir va gipoksiyaning ko'payishiga olib kelishi mumkin. Ko'pgina o'smalarda kislorod darajasi allaqachon patologik diapazonda bo'lganligi sababli, bu juda muhim gipoksik insultga olib kelishi mumkin.

Biz buni PC3 prostata o'smalarida dotsetaksel sitotoksik preparat bilan ko'rsatdik, bu esa deksametazon bilan yanada kuchli antigiogen ta'sirini keltirib chiqardi. Bu nima uchun metastatik prostata saratoni bilan og'rigan bemorlarda bu kombinatsiyaning qisqa muddatli (uzoq muddatli bo'lmasa ham) samaradorligi borligini tushuntirishi mumkin. 82 Yuqorida muhokama qilinganidek, antiandrogen bikalutamid o'simta tomirlariga o'xshash boshlang'ich va chuqur ta'sir ko'rsatadi, bu ta'sir biz boshqa mexanik jihatdan turli antitumor dorilar bilan ham topilgan (bizning nashr etilmagan ma'lumotlarimiz). Biroq, o'smalar bu gipoksik tahqirlashga moslasha oladi va ular pro-angiogen va potentsial xavfli fenotip bilan tiklanadi. 44,83,84 Ushbu muammoni qisman, hech bo'lmaganda, boshqa CCT bilan birgalikda engish mumkin. Gipoksiya bilan faollashtirilgan dorilar (HAPlar) (quyida muhokama qilinadi) qo'shimcha yondashuvni taklif qiladi, chunki ular gipoksik hujayralarga qaratilgan. Ko'rinib turibdiki, dorilarning kombinatsiyasini, shu jumladan HAPni yanada samarali rejalashtirish uchun, hozirgi davo usullari bilan o'simta kislorodining uzunlamasına o'zgarishini yaxshiroq tushunish kerak.


1.KIRISH

T hujayralari va ayniqsa sitotoksik CD8 + T limfotsitlari (CTLs) uzoq vaqt davomida immunogen o'smalarning rivojlanishini cheklashda muhim ahamiyatga ega ekanligi e'tirof etilgan. Ko'p o'smalarda CTLlarning mavjudligi ijobiy prognostik omil hisoblanadi. 2 Aksincha, antitumoral immunitetning pasayishi o'sayotgan o'smalarning o'ziga xos belgisidir. 3 Saratonga qarshi T hujayralari tomonidan boshqariladigan immun nazorati kontseptsiyasi T hujayralarining in situ funktsiyasini tiklashga asoslangan immunoterapiyalarni ishlab chiqishga olib keldi, asosan immun nazorat nuqtasi retseptorlariga qaratilgan antikorlar orqali yoki genetik jihatdan o'zgartirilgan autolog T hujayralarini kuchaytirilgan. antitumoral faollik, asosan kimerik antigen retseptorlari (CAR)-ekspressiv T hujayralari. Ikkala strategiya ham metastatik saraton bilan og'rigan bemorlarda misli ko'rilmagan darajada uzoq muddatli antitumor faolligini ta'minladi. Biroq, rivojlangan saraton kasalligi bilan og'rigan bemorlarning aksariyati hali ham immunoterapiyadan barqaror klinik foyda ko'rmaydilar, bu ularni bartaraf etish strategiyalarini ishlab chiqish uchun aniqlanishi kerak bo'lgan to'siqlar mavjudligini ta'kidlaydi. T-hujayralarining samarasiz migratsiyasi va xususan, o'simta massasiga kirib borishi T hujayralariga asoslangan immunoterapiya uchun muhim to'siq bo'lishi mumkin. Bu tushunchani qo'llab-quvvatlovchi turli klinik tadqiqotlar shuni ko'rsatdiki, T hujayralari bilan boyitilgan o'smalar dasturlashtirilgan hujayra o'limi-1 (PD-1) blokadasi tomonidan boshqarilishga ko'proq moyil. In contrast, tumors with so-called “immune deserts” and immune excluded profiles, in which T cell are present within tumors but not in contact with malignant cells, are refractory to PD-1 blockade. 5 Migration might represent an even greater challenge for CAR T cell therapy, because the in vitro expanded T cells that are infused into the blood circulation need to home to the site of tumor development and then migrate toward the tumor mass.

There is currently a wide gap in our knowledge of the homing and migratory properties of CAR T cells, as well as to the location of these therapeutic cells over prolonged periods. The objective of this review is therefore to address key open questions, such as: what are the capacities of infused therapeutic T cells to home to target organs? How does the tumor microenvironment influence the motility behavior of engineered T cells? What are the strategies, which have been implemented to restore a defective CAR T cell migration? How should homing and motility properties of adoptively transferred T cells be monitored in preclinical models? By highlighting these points, we hope to stimulate a research focus at the interface between basic T cell biology and therapeutic development that will ultimately open new opportunities to improve antitumoral T cell based strategies.


Hypoxia Diminishes Electron Transport

Multiple studies throughout the 1970s and 1980s examined the oxygen dependence of the ETC (108, 109). These studies observed that exposure of cells to acute hypoxia (minutes to seconds) did not attenuate the flux of electrons through the ETC nor increase NADH levels in mitochondria. However, in the mid-1990s we reported that isolated mitochondria decreased coupled respiration and that isolated COX decreased its maximal velocity (Vmaks) when exposed to chronic hypoxia (2 h) (30, 32). Thus there is an intrinsic oxygen dependence of COX during prolonged hypoxia. Another important regulator of COX activity is nitric oxide (NO) (36). Low concentrations (nM range) of NO reversibly inhibit isolated COX by competing with oxygen (15, 35, 80). Under aerobic conditions, oxygen levels are high enough to prevent NO from inhibiting COX activity (36). However, as oxygen levels fall, the low levels of NO are sufficient to inhibit COX activity. Low levels of NO under normoxia do not injure cells. However, the same low levels of NO are sufficient to inhibit respiration and initiate cell death under hypoxia (1.5% O2) (76). In the absence of NO, hypoxia alone does not have any deleterious effects on cells. It is likely that COX activity is compromised in inflammatory conditions where NO levels are high with concomitant tissue hypoxia. Furthermore, the NO-generating enzyme inducible NO synthase (iNOS) is a target of HIF-1 (65, 85). We propose that hypoxia diminishes COX activity by decreasing the Vmaks of COX activity and by increasing NO levels to inhibit COX activity. Although this mechanism diminishes COX activity during hypoxia, the activity cannot be diminished to the point where respiration fails to meet the basal metabolic demands of cells. Therefore, cells ensure optimal COX activity during hypoxia by activating HIF-1 to induce subunit switch from COX4–1 subunit to COX4–2 (44). COX has 13 subunits, of which the three catalytic subunits COX I-III are encoded by mitochondrial DNA. The remaining regulatory 10 subunits including COX4 subunits are encoded by nuclear DNA. HIF-1 induces both the expression of the COX4–2 subunit and the mitochondrial protease LON, which targets COX4–1 subunit degradation to complete the switching of the COX4 subunits during hypoxia. Recently, another mechanism to downregulate the ETC is the finding that micro-RNA 210 (mir-210) blocks the expression of the iron-sulfur cluster assembly proteins ISCU1/2, which are required for the functions of complex I, COX subunit 10, aconitase, and subunit D of succinate dehydrogenase (28, 33, 42, 91). Using a miRNA microarray, Kulshreshta et al. (74) first discovered that miR-210 is regulated by hypoxia, and recently it was proposed to be the major micro-RNA upregulated during hypoxia. HIF-1, but not HIF-2, is responsible for the induction of mir-210 during hypoxia (57). The ectopic expression of mir-210 is sufficient to decrease mitochondrial respiration and upregulate glycolysis (33). Thus there are multiple mechanisms by which HIF-1 can coordinately diminish electron flux through the ETC (Fig. 3).

3 -rasm.Hypoxia diminishes electron flux through the electron transport chain. Hypoxia diminishes respiratory activity by activating HIF-1, which increases micro-RNA 210 (miR-210), inducible nitric oxide synthase (iNOS), and switching of cytochrome v oxidase (COX)4–1 subunit to COX4–2. Hypoxia can also directly decrease complex IV (COX) activity.


3 NATIJA

3.1 Patient demographics

Table 1 summarizes the basic characteristics of the 70 patients (NACRT and US groups). In the NACRT group, the median age of the patients was 66 years, and 24 of them (60%) were male. NACRT was performed in three patients with R-PDAC, 35 patients with BR-PDAC, and two patients with LA-PDAC. A pancreatoduodenectomy was performed in 31 patients (79%). The NACRT group had a higher proportion of pretreatment diagnosis for BR- or LA-PDAC (93% vs 53%, P < .01) and a lower percentage of lymph node metastasis (40% vs 80%, P < .01) compared with the US group. However, the differentiation status of tumors, tumor size, and proportion of resection margin–negative were similar between the two groups.

Xususiyatlar NACRT BIZ NACRT vs US
N = 40 N = 30 P qiymat
Age (y) 66 (51-78) 68 (52-84) .44
Male gender 24 (65%) 16 (53%) .28
Pretreatment diagnosis: R/BR/LA 3 (8%)/35 (88%)/2 (5%) 14 (47%)/16 (53%)/0 <.01
Procedure: SSPPD(TP)/DP 31 (79%)/9 (22%) 19 (63%)/11 (37%) .15
Poor differentiation 4 (10%) 0 .07
ypTS 2.7 (0.9-5.5) 2.9 (1.0-4.3) .14
Nodal metastasis 12 (40%) 24 (80%) <.01
Stage IA/IB/IIA/IIB/III 10 (25%)/17 (43%)/1 (3%)/9 (23%)/3 (8%) 3 (10%)/5 (17%)/0/16 (53%)/6 (20%) .01
Treatment effect, Evans grade I/IIA/IIB/III 9 (19%)/20 (50%)/8 (20%)/3 (8%) - -
Resection margin–negative 34 (85%) 23 (77%) .28
Recurrence 28 (70%) 20 (67%) .77
  • Abbreviations: BR, borderline resectable DP, distal pancreatectomy LA, locally advanced NACRT, neoadjuvant chemoradiotherapy R, resectable SSPPD, subtotal stomach-preserving pancreatoduodenectomy TP, total pancreatectomy US, upfront surgery.

3.2 Immune cell distribution according to preoperative treatment

As shown in Figure 2, all immune cells were present in both the cancer stroma and the cancer cell nests of PDAC samples. These cells were found to be more abundant in the cancer stroma than in the cancer cell nest regardless of preoperative therapy. Figure 2 shows a comparison of immune cell distributions between the NACRT and US groups. Although the cancer stromal counts of CD4+ T cells, CD20+ B cells, and Foxp3+ T cells in the NACRT group were drastically decreased compared with those in the US group, these counts in the cancer cell nests were not different between the two groups. In contrast, CD204+ macrophage counts in the cancer stroma were similar between the NACRT and US groups, whereas those in the cancer cell nests were significantly reduced in the NACRT group. PD-L1+ carcinoma cell counts in the NACRT group were substantially lower in comparison with the US group (Table 2). These results suggest that alterations in TIICs following NACRT appear to be very different from those in cancer stromal immune cells.

Characteristics (count/mm 2 ) NACRT BIZ NACRT vs US
N = 40 N = 30 P qiymat
CD3+ CD4+ T cell (stroma) 77.5 (13.5-365.7) 92.9 (4.9-397.0) .561
CD3+ CD4+ T cell (cancer cell nest) 9.0 (0.0-82.6) 4.4 (0.0-38.2) .056
CD3+ CD8+ T cell (stroma) 77.3 (17.9-418.8) 139.6 (25.2-684.3) .017
CD3+ CD8+ T cell (cancer cell nest) 16.4 (0.0-173.3) 19.7 (3.5-262.1) .367
CD20+ B cell (stroma) 1.3 (0.0-18.9) 16.5 (0.0-253.4) < .001
CD20+ B cell (cancer cell nest) 0.0 (0.0-11.9) 0.0 (0.0-5.6) .100
CD3+ Foxp3+ T cell (stroma) 4.4 (0.0-73.5) 19.4 (0.1-118.6) .005
CD3+ Foxp3 + T cell (cancer cell nest) 0.5 (0.0-17.0) 1.8 (0.0-17.4) .072
CD204+ cell (stroma) 252.4 (53.0-959.6) 278.6 (2.7-693.8) .302
CD204+ cell (cancer cell nest) 16.7 (0.0-137.6) 56.3 (6.1-150.0) .001
PD-L1 high carcinoma 0.0 (0.0-25.4) 2.2 (0.0-521.3) < .001

3.3 Association between TIICs and early recurrence of disease in the NACRT group

The count of each immune cell found in carcinomas was divided into low and high groups according to the cutoff value (set as the median amount). Kaplan-Meier curve analysis demonstrated that only patients with high CD204+ macrophage counts in the cancer cell nest (>16.7 counts/mm 2 ) had significantly shorter RFS times compared with patients with low CD204+ macrophage counts in the cancer cell nest (Figure 3). Univariate and forest plot analyses suggested that high PD-L1 expression and the presence of CD204+ macrophages in the cancer cell nest were associated with shorter RFS (Table 3 and Figure S2). Following multivariate analysis, only high CD204+ macrophage counts in the cancer cell nest remained an independent predictor of shorter RFS (Table 3). There were no significant differences in the basic characteristics between the groups with high and low CD204+ macrophage counts in the cancer cell nest (Table 4).

Variables Univariate Multivariate
MRFS (months) P qiymat OR (95% CI) P-qiymat
CD3+ CD4+ T cell (cancer cell nest) < 9.0 13.5 .360
>9.0 18.7
CD3+ CD8+ T cell (cancer cell nest) < 16.4 15.2 .622
>16.4 12.9
CD20+ B cell (cancer cell nest) < 0.0 15.2 .747
>0.0 6.6
CD3+ Foxp3+ T cell (cancer cell nest) < 0.5 13.5 .667
>0.5 18.7
CD204+ cell (cancer cell nest) < 16.7 25.0 .032 2.366 (1.074-5.215) .033
>16.7 6.9
PD-L1 high carcinoma (cancer cell nest) < 0.0 22.5 .091 2.001 (0.912-4.390) .084
>0.0 6.9
Xususiyatlar High CD204+ (cancer cell nest) Low CD204+(cancer cell nest) High vs low
N = 20 N = 20 P-qiymat
Age (y) 66 (51-78) 66 (54-78) .34
Male gender 14 (70%) 10 (50%) .17
Pretreatment diagnosis: R/BR/LA 2 (10%)/16 (80%)/2 (10%) 1 (5%)/19 (95%)/0 .27
Procedure: SSPPD(TP)/DP 31 (79%)/9 (22%) 19 (63%)/11 (37%) .15
Poor differentiation 2 (10%) 2 (10%) 1.00
ypTS 2.5 (0.9-5.5) 3.0 (1.0-4.0) .51
Nodal metastasis 4 (20%) 8 (40%) .17
Resection margin–negative 3 (15%) 3 (15%) 1.00
Recurrence 16 (80%) 12 (60%) .15
  • Abbreviations: BR, borderline resectable DP, distal pancreatectomy LA, locally advanced R, resectable SSPPD, subtotal stomach-preserving pancreatoduodenectomy TP, total pancreatectomy ypTS, pathological tumor size.

Tight Control of Hypoxia-inducible Factor-α Transient Dynamics Is Essential for Cell Survival in Hypoxia

Intracellular signaling involving hypoxia-inducible factor (HIF) controls the adaptive responses to hypoxia. There is a growing body of evidence demonstrating that intracellular signals encode temporal information. Thus, the dynamics of protein levels, as well as protein quantity and/or localization, impacts on cell fate. We hypothesized that such temporal encoding has a role in HIF signaling and cell fate decisions triggered by hypoxic conditions. Using live cell imaging in a controlled oxygen environment, we observed transient 3-h pulses of HIF-1α and -2α expression under continuous hypoxia. We postulated that the well described prolyl hydroxylase (PHD) oxygen sensors and HIF negative feedback regulators could be the origin of the pulsatile HIF dynamics. We used iterative mathematical modeling and experimental analysis to scrutinize which parameter of the PHD feedback could control HIF timing and we probed for the functional redundancy between the three main PHD proteins. We identified PHD2 as the main PHD responsible for HIF peak duration. We then demonstrated that this has important consequences, because the transient nature of the HIF pulse prevents cell death by avoiding transcription of p53-dependent pro-apoptotic genes. We have further shown the importance of considering HIF dynamics for coupling mathematical models by using a described HIF-p53 mathematical model. Our results indicate that the tight control of HIF transient dynamics has important functional consequences on the cross-talk with key signaling pathways controlling cell survival, which is likely to impact on HIF targeting strategies for hypoxia-associated diseases such as tumor progression and ischemia.

Author's Choice—Final version full access.

Ikkala muallif ham bu ishga teng hissa qo'shgan.

Recipient of a Biotechnology and Biological Sciences Research Council doctoral training studentship.

Holds University of Liverpool studentship.

Recipient of a Medical Research Council capacity building studentship.

Present address: Faculty of Life Sciences, University of Manchester, Manchester M13 9PT, United Kingdom.


Kirish

Skeletal muscles undergo structural and functional adaptations to various stimuli including mechanical (e.g., exercise) and environmental (e.g., systemic hypoxia) stimuli. Endurance exercise training results in improved muscle oxidative capacity (Holloszy and Booth 1976 ), whereas resistance exercise training leads to increases in muscle size and strength (McDonagh and Davies 1984 ). Endurance exercise training (5–6 times/week for 3–6 weeks at 70–80% maximal oxygen uptake) performed in systemic hypoxia induces a greater increase in muscle oxidative capacity when compared to endurance exercise training under normoxia (Desplanches et al. 1993 Geiser et al. 2001 ). This suggests that skeletal muscle adaptations are specific to the type of exercise stimuli, and that the combination of exercise and systemic hypoxia may have a synergistic effect on skeletal muscle adaptations such as muscular endurance.

It is generally recognized that endurance exercise training causes a significant increase in skeletal muscle capillarization, characterized by an elevated capillary density and capillary-to-fiber ratio (Andersen 1975 Brodal et al. 1977 Hudlicka et al. 1992 ). This physiological adaptation contributes to enhanced aerobic capacity via an increase in the transport, conductance, and extraction of oxygen in skeletal muscle. Vascular endothelial growth factor (VEGF) (Folkman and Shing 1992 Hudlicka et al. 1992 van Weel et al. 2004 Olfert et al. 2009 ), the generation of nitric oxide by nitric oxide synthase (NOS) (Baum et al. 2004 , 2013 ), and peroxisome proliferator-activated receptor-g coactivator-1a (PGC-1a) (Arany et al. 2008 Leick et al. 2009 ) are positive regulators of angiogenesis in skeletal muscle. Among these regulators, VEGF is known to play a critical role in increasing angiogenesis. When compared with wild-type mice, VEGF transgenic mice (van Weel et al. 2004 ) and muscle-specific VEGF knock-out mice (Olfert et al. 2009 ), respectively, have increased and decreased skeletal muscle capillary density. Both NOS (Baum et al. 2013 ) and PGC-1a (Leick et al. 2009 ) knock-out mice have decreased skeletal muscle VEGF expression and capillary-to-fiber ratio. Acute high-intensity resistance exercise (three sets of 10 repetitions of two legged knee extensor exercise at 60–80% of 1RM) in humans increases the expression of skeletal muscle VEGF mRNA and protein (Gavin et al. 2007 ). Hypoxic stimuli in cells also increase VEGF mRNA levels through the activation of the nuclear transcription factor, hypoxia-inducible factor-1 (HIF-1) (Forsythe et al. 1996 ). Thus, it is possible that resistance exercise training under systemic hypoxia, when compared with normoxia, causes a greater increase in skeletal muscle VEGF and capillarization potentially leading to increased muscular endurance.

Therefore, this study investigated the effects of resistance exercise training under systemic hypoxia on the angiogenic response and muscular endurance in human skeletal muscle. We hypothesized that resistance exercise training under systemic hypoxia would lead to a greater development of muscular endurance and greater increase in angiogenic and mitochondrial responses as demonstrated by increases in VEGF, PGC-1a, NOS, and capillary-to-fiber ratio.


4 EXPERIMENTAL PROCEDURES

4.1 Chick embryos

According to Swedish regulations (Jordbruksverkets föreskrift L150, §5) work on chick embryos younger than embryonic day 13 do not require Institutional Animal Care and Use Committee oversight.

4.2 Human and mouse fetal tissue

Human fetal tissue (ethical approval Dnr 6.1.8-2887/2017, Lund University, Sweden) was obtained from elective abortions. Tissue samples were dissected in custom-made hibernation medium (Life Technologies, Carlsbad, California) and fixed in 4% formaldehyde overnight. Following a sucrose gradient, embryos were embedded in gelatin for transverse sectioning at 12 μm (ew5) or 7 μm (ew6) using a cryostat.

4.3 Cell culture

The human neuroblastoma cell line SK-N-BE(2)c (ATCC Manassas, Virginia) was cultured in MEM supplemented with 10% fetal bovine serum and 100 units penicillin and 10 μg/mL streptomycin. As part of our laboratory routines, all cells were maintained in culture for no more than 30 continuous passages and regularly screened for mycoplasma. SK-N-BE(2)c cells were authenticated by SNP profiling (Multiplexion, Germany).

4.4 Embryos and perturbations

Chick embryos were acquired from commercially purchased fertilized eggs and incubated at 37.5°C until desired developmental Hamburger Hamilton (HH) stages were reached. 10 Optimal conditions for high transfection efficiency applying one-sided electroporation in ovo were determined to 5 pulses of 30 ms each at 22 V. Ringer's balanced salt solution (solution-1:144 g NaCl, 4.5 g CaCl•2H2O, 7.4 g KCl, ddH2O to 500 mL solution-2:4.35 g Na2HPO4•7H2O, 0.4 g KH2PO4, ddH2O to 500 mL [adjust final pH to 7.4]) containing 1% penicillin/streptomycin was used in all experiments. Morpholinos used were from GeneTools with the following sequences splice targeting EPAS1 oligo (5′-GAAAGTGTGAGGGAACAAGTTACCT-3′) and a corresponding 5′-mispair oligo (5′-GAtAcTGTcAGGcAACAAcTTACCT-3′). Morpholinos were injected at a concentration of 1 mM and co-electroporated with a GFP tagged empty control vector (1 μg/μL). RFP-tagged EPAS1 overexpression construct or corresponding empty control vector were electroporated at a concentration of 2.5 μg/μL. CRISPR constructs with gRNA nontargeting control (#99140, Addgene) or gRNAs targeting EPAS1 (EPAS1.1.gRNA Top oligo—5′ ggatgGCTCAGAACTGCTCctacc 3′, Bot oligo—5′ aaacggtagGAGCAGTTCTGAGCc 3′ EPAS1.2.gRNA Top oligo—5′ ggatgAAGGCATCCATAATGCGCC 3′, Bot oligo—5′ aaacGGCGCATTATGGATGCCTTc 3′ EPAS1.3.gRNA Top oligo—5′ ggatgAAATACATGGGTCTCACCC 3′, Bot oligo—5′ aaacGGGTGAGACCCATGTATTTc 3′) were cloned into U6.3 > gRNA.f + e (#99139, Addgene) and electroporated at a concentration of 1.5 μg/μL, and accompanying Cas9-GFP (#99138, Addgene) at 2 μg/μL. 40 All constructs were injected at HH stage 10+/11 into the lumen of the neural tube from the posterior end and embryos were electroporated in ovo applying electrodes 4 mm apart, covering the whole embryo. One-sided electroporation was performed to allow for an internal control side within each individual embryo. Embryos were allowed to sit at room temperature for 6 to 10 hours before further incubation of the embryos at 37.5°C in order to allow the Cas9 protein to fold. Importantly, apart for analysis on embryo growth (ie, age determination), all analyses were performed on sections/cells at the trunk axial level of the embryo.

For harvesting of tissue for RNA extraction, embryos were incubated at 37.5°C for 24 (morpholinos and overexpression vectors) or 36 (CRISPR/Cas9) hours postelectroporation. The trunk portion of neural tubes was dissected and immediately snap frozen before RNA extraction and qPCR analysis.

4.5 Cloning

To overexpress HIF-2α, the Gallus gallus EPAS1 coding sequence was amplified using the following primers Fwd:

5′AAACTCGAGGCCACCATGGACTACAAAGACGATGACGACAAGGCAGGTATGACAGCTGACAAGGAGAAG-3′, Rev 5′-AAAGCTAGCTCAGGTTGCCTGGTCCAG-3′ and cloned into the pCI H2B-RFP vector (Addgene plasmid #92398). For CRISPR/Cas9 targeting, oligos designed to target EPAS1 at three different locations (EPAS1.1, EPAS1.2, and EPAS1.3) were annealed pairwise at a concentration of 100 μM per oligo using T4 DNA Ligase Buffer in dH2O by heating to 95°C for 5 minutes. The annealed oligo reactions were cooled to room temperature and diluted. The U6.3 > gRNA.f + e (#99139, Addgene) vector was digested over night with BsaI-HF enzyme (New England Biolabs) and gel extracted. gRNAs were cloned into the digested U6.3 > gRNA.f + e vector using T4 DNA Ligase (New England Biolabs) at room temperature for 20 minutes. Successful inserts were identified by colony PCR using U6 sequencing primer and gRNA reverse oligo specific to each EPAS1 gRNA.

4.6 Neural tube dissections for crestosphere cultures

Neural tubes from respective axial levels were carefully dissected out from embryos at designated somite stages. For cranial-derived cultures, the very anterior tip was excluded, and the neural tube was dissected until the first somite level as previously described. 26 For trunk-derived cultures, the neural tube was dissected between somite 10 to 15 as previously described. 24, 25 Pools of neural tubes from four to six embryos were used for each culture.

4.7 Crestosphere cell culture

Neural tube derived cells were cultured in NC medium (DMEM with 4.5 g/L glucose (Corning), 7.5% chick embryo extract (MP Biomedicals, Santa Ana,California), 1X B27 (Life Technologies), basic fibroblast growth factor (bFGF, 20 ng/mL) (Peprotech, Stockholm, Sweden), insulin growth factor-I (IGF-I, 20 ng/mL) (Sigma Aldrich, Darmstadt, Germany), retinoic acid (RA 60 nM for cranial and 180 nM for trunk, respectively) (Sigma Aldrich), and 25 ng/mL BMP-4 (for trunk) (Peprotech)) in low-adherence T25 tissue culture flasks as described previously. 24, 25

4.8 Self-renewal assay

Chick embryos at developmental HH stage 10+/11 were injected and electroporated with CRISPR/Cas9 constructs and allowed to develop at 37.5°C to reach HH stage 13 + /14 − . Crestosphere cultures were established from embryos electroporated with control, EPAS1.1 or EPAS1.2 constructs. Crestospheres were dissociated into single cells using Accutase (Sigma Aldrich incubation at 37°C for 40 minutes with 1 minute of pipetting every 10 minutes), and individual cells were manually picked using a p10 pipette tip under a microscope. Single cells were transferred to 96-well plates prepared with 100 μL of NC medium supplemented with RA and BMP-4. 25 The absolute number of spheres formed in each well was quantified manually under the microscope. Sphere diameter was manually measured using the ImageJ software (spheres measured n = 33 and n = 27 for CTRL and EPAS1.2, respectively).

4.9 EdU pulse chase labeling

Proliferation was measured using the Click-iT EdU Cell Proliferation kit (Invitrogen #C10337) according to the manufacturer's recommendations with optimizations from Warren et al. 23 Chick embryos at developmental HH stage 10+/11 were injected and electroporated with morpholino or overexpression constructs and allowed to develop for an additional 24 hours at 37.5°C. Eggs were then reopened and EdU solution (500 μM in PBS-DEPC) was added. Eggs were resealed and incubated at 37.5°C for another 4 hours before dissection in Ringer's solution and fixed in 4% paraformaldehyde overnight. Embryos were washed in PBS-DEPC, H2O, and 3% BSA in PBS-DEPC before permeabilization in 0.5% Triton-X. Embryos were hybridized in reaction cocktail (Click-iT Reaction buffer, CuSO4, Alexa Fluor 488 Azide and reaction buffer additive), washed and DAPI stained. Embryos were after another round of washing processed through a sucrose gradient and embedded in gelatin.

4.10 Whole mount in situ hybridization

For whole mount in situ hybridization, embryos were fixed in 4% PFA and washed in DEPC-PBT. Samples were gradually dehydrated by bringing them to 100% MeOH and kept at −20°C until use. In situ hybridization was performed as previously described. 41 Embryos were rehydrated back to 100% PBT, treated with Proteinase K/PBT, washed in 2 mg/mL glycine/PBT and postfixed in 4% paraformaldehyde/0.2% glutaraldehyde for 20 minutes. Embryos were then prehybridized in hybridization buffer for 2 hours at 70°C and hybridized with Digoxigenin (DIG)-labeled TFAP2B probe overnight at 70°C. Embryos were washed in wash solutions I and II (50% formamide, 1% sodium dodecyl sulfate [SDS] and 5X SSC [NaCl and Na citrate] or 2X SSC, respectively), and blocked in 10% sheep serum for 2 hours followed by incubation with an anti-DIG antibody (1:2000) (Roche) in TBST/1% sheep serum overnight at 4°C. On day 3, embryos were washed in TBST throughout the day and overnight. Embryos were washed in alkaline phosphatase buffer (NTMT 100 mM NaCl, 100 mM Tris-Cl [pH 9.5], 50 mM MgCl2, 1%Tween-20) before visualizing the signal using NBT/BCIP (Sigma Aldrich). Stained embryos were rinsed in PBT for 20 minutes and postfixed in 4% PFA/ 0.1% glutaraldehyde overnight when considered complete. Embryos were then dehydrated in MeOH to be stored at −20°C. Embryos were later embedded in blocks of gelatin for transverse sectioning at 8 μm using a cryostat. Hybridization probe for avian TFAP2B was a kind gift from Dr Felipe Vieceli.

4.11 RNA sequencing

Chick embryos of stage HH10+/11 were from the posterior end injected with EPAS1 targeting or corresponding 5′-mispair morpholinos into the lumen of neural tubes and subsequently electroporated for construct uptake. Following 24 hours of incubation at 37.5°C, embryos were removed from the eggs in Ringer's solution. The neural tube portion at the trunk axial level of individual embryos were carefully dissected, removing surrounding mesodermal tissue, and transferred to Eppendorf tubes (neural tube tissue from one embryo per Eppendorf) that were snap frozen. RNA was extracted from each individual neural tube (five samples per condition [EPAS1 and 5′-mispair, respectively]) using the RNAqueous Micro Kit (Ambion, #AM1931). Sequencing was performed using NextSeq 500 (Illumina). Alignment of reads was performed using the HISAT2 software and the reference genome was from the Ensemble database (Gallus gallus 5.0). Expression counts were performed using the StringTie software and DEG analysis was performed using DESeq2. To obtain a relevant working list out of the 1105 significantly DEGs, we set a cut-off at P < .005 and removed all hits that were NA, ending up with 97 genes. Ahamiyati (P values) was DESeq2 derived. 42 RNA sequencing data have been deposited in NCBI's Gene Expression Omnibus 43 and are accessible through GEO Series accession number GSE140319.

4.12 Bioinformatics

GSEA for gene ontology, network and functional analyses were generated through the use of Panther database (analyses performed autumn 2018 (http://pantherdb.org/) 44 together with the Ingenuity Pathway Analysis (IPA) software 45 (QIAGEN Inc., https://www.qiagenbioinformatics.com/products/ingenuity-pathway-analysis). For a hypothesis-free/exploratory analysis of the 97 DEGs, IPA was used (P-value calculations using right-tailed Fisher Exact Test). IPA was mainly used for deeper exploration of the data where the biological hypotheses generated for the project were further explored. Here, a hypotheses-driven approach was taken where the following categories found from the IPA analysis of the 97 DEGs were further investigated “Cellular Movement,” within the “Molecular and Cellular Function” result category, “Embryonic Development,” within the category “Physiological System Development and Function,” and “Tumor Morphology,” within the “Disease and Disorders” category. These three biological networks were further investigated within the data set at hand. The investigation for the possible overlap and connections between these networks in the context of the data were hence explored.

4.13 Cryosections

Fixed embryos were incubated in a sucrose gradient (5% sucrose for 10 minutes and 15% sucrose for 10 minutes up to several hours) followed by incubation in 7.5% gelatin over night at 37°C. Gelatin embedded samples were cryosectioned at 7 to 20 μm.

4.14 Immunohistochemistry and immunofluorescence

Immunohistochemistry on mouse fetal tissue for HIF-2α (NB100-132, Novus Biologicals) and TH (ab112, Abcam) was performed using Autostainer (Dako). Sections were counterstained with hematoxylin. Detection of HIF-2α by immunofluorescence was performed on sections from the trunk axial level of embryos (avian and human) that had been harvested, fixed as whole embryos in 4% PFA overnight, incubated in 5% sucrose for 10 minutes, 15% sucrose for 4 hours and gelatin overnight. Embryos were then embedded in gelatin and snap frozen. Dry embryo sections were incubated in ice-cold acetone followed by 0.3% Triton-X in PBS. After washing in PBS, slides were blocked in DAKO serum-free ready-to-use block (DAKO, #X0909) for 1 hour before incubation with primary antibodies (in DAKO antibody diluent with background reducing components [DAKO, #S3022]) overnight (HIF-2α, ab199, Abcam HNK-1, 3H5, DSHB). Slides were washed in PBS and incubated with rabbit linker (DAKO, #K8019) followed by secondary antibody in 1% BSA/PBS. Detection of HNK1 and SOX9 by immunofluorescence was performed by blocking (10% goat serum and 0.3% Triton-X in TBST) of embryo sections followed by incubation with primary antibodies (SOX9, ab5535, Millipore) over night at +4°C. Slides were washed and incubated with secondary antibodies and DAPI for nuclear staining for 1 hour at RT before washing and mounting. Fluorescent images were acquired using an Olympus BX63 microscope, DP80 camera, and cellSens Dimension v 1.12 software (Olympus Cooperation). Detailed information on antibodies can be found in Table 6.

Turlar Suyultirish Manba Product #
IF antibodies
Primary antibody
HNK1 Sichqoncha 1:5 Hybridoma bank 3H5
HIF-2a Quyon 1:50 Abcam ab199
SOX9 Quyon 1:1000 Millipore ab5535
Secondary antibody
Anti-mouse Alexa Fluor-594 Goat 1:1000 Invitrogen A-11032
Anti-rabbit Alexa Fluor-546 Donkey 1:1000/1:500 Invitrogen A-10040
Anti-mouse Alexa Fluor-488 Goat 1:1000 Invitrogen A-11008
IHC antibodies
Primary antibody
HIF-2a Sichqoncha 1:1000 Novus Biologicals NB100-132
HIF-2a Quyon 1:4000 Abcam ab199
TH Quyon 1:1600 Abcam ab112
In situ antibodies
Anti-dig-AP Sichqoncha 1:2000 Roche Diagnostics 11 093 274 910
Nuclear staining
DAPI 1:3000 Dako D3571
Western blot antibodies
Primary antibody
HIF-2a Quyon 1:200 Abcam ab199
SDHA Sichqoncha 1:4000 Abcam ab14715
Secondary antibody
Anti-rabbit Monkey 1:3000 Invitrogen 65-6120
Anti-mouse Qo'y 1:5000 Invitrogen 62-6520

4.15 Western blot

Extracted proteins were separated by SDS-PAGE, transferred to HyBond-C-Extra nitrocellulose membranes, blocked, and incubated with primary antibodies (HIF-2α, ab199, Abcam SDHA, ab14715, Abcam) at 4°C overnight. The next day, membranes were incubated with HRP-conjugated antibodies and proteins detected by ECL solution. Detailed information on antibodies can be found in Table 6.

4.16 RNA extraction and quantitative real-time PCR

Total RNA was extracted using the RNAqueous Micro Kit (Ambion, #AM1931). cDNA synthesis using random primers and qRT-PCR was performed as previously described. 27 Relative mRNA levels were normalized to expression of two reference genes (18S, 28S) using the comparative Ct method. 46 Detailed information of primer sequences can be found in Table 7.

Maqsadli gen 5′-3′
18S (reference gene) Fwd CCATGATTAAGAGGGACGGC
Rev TGGCAAATGCTTTCGCTTT
28S (reference gene) Fwd GGTATGGGCCCGACGCT
Rev CCGATGCCGACGCTCAT
EPAS1 Fwd GGCACCAATACCATGACGA
Rev CATGTGCGCGTAACTGTCC
SOX10 Fwd AGCCAGCAATTGAGAAGAAGG
Rev GAGGTGCGAAGAGTTGTCC
B3GAT1 Fwd TTGTGGAGGTGGTGAGGA
Rev GGCTGTAGGTGGGTGTAATG
TFAP2B Fwd CCCTCCAAAATCCGTTACTT
Rev GGGGACAGAGCAGAACACCT
HOXC9 Fwd TAAGCCACGAAAACGAAGAG
Rev GAAGGAAAGTCGGCACAGTC
HOXA2 Fwd AGGCAAGTGAAGGTCTGGTT
Rev TCGCCGTTCTGGTTCTCC
NGFR Fwd AGCAGGAGGAGGTGGAGAA
Rev CCCGTGTGAAGCAGTCTATG
HES6 Fwd GCTGATGGCTGATTCCAAAG
Rev TCGCAGGTGAGGAGAAGGT
AGPAT4 Fwd TGCTGGGCGTTCTAAATGG
Rev ACACTCCTGCTCATCTTCTGG
HES5 Fwd GTATGCCTGGTGCCTCAAA
Rev GCTTGTGACCTCTGGAAATG
RASL11B Fwd GCTGGGCTGTGCTTTCTATG
Rev GGTGCTGGTGGTCTGTTGTT
FMN2 Fwd CCATCAGCCAGTCAAGAGGA
Rev TAAAGCATCGGGAGCCAAAC
TAGLN3 Fwd AGGCAGCATTTCCAGACC
Rev ATGGGTTCGTTTCCCTTTG
NRCAM Fwd TCATTCCGTGTGATTGCTGT
Rev AAGGATTTTCATCGGGGTTT
EGFP Fwd CCGACCACTACCAGCAGAAC
Rev TTGGGGTCTTTGCTCAGG

4.17 RNAi experiments

SK-N-BE(2)c cells were transfected with ON-TARGETplus Nontargeting Control siRNA #2 (D-001810-02-05), ON-TARGETplus siRNA Targeting human HIF1Α (J-004018-07) or ON-TARGETplus siRNA Targeting human EPAS1 (J-004814-06), all from Dharmacon, using Lipofectamine 2000 or RNAiMAX. Cells were then placed in 21% or 1% oxygen for 48 hours before harvest. SK-N-BE(2)c cells were treated with 200 μM 2,2′-dipyridyl (DIP), an iron chelator that promotes stabilization of HIF-α at normoxic conditions for 4 hours before harvest and were used as positive control for western blot detection of HIF-2α.

4.18 Oxygen sensing

Oxygen concentrations were measured through the trunk region of developing chick embryos ex ovo within 30 minutes from dissection using microsensors in a flow system of MQ water. We performed trials to confirm that oxygen concentrations are largely stable within the tissue ex ovo over at least 5 hours. Microprofiles were measured in 50 embryos in developmental stages HH10 to HH24. Embryos were removed from the egg using filter paper as described in Mohlin and Kerosuo, 24 submerged in a plate with constant flow of newly shaken MQ of room temperature, and immediately measured. Oxygen microsensors were constructed and calibrated as described by Revsbech and Andersen, 47 mounted on a micromanipulator. The microsensor was manually probing the trunk region and data logged every second. Within the microprofile, 10 consecutive data points of the lowest oxygen concentrations were averaged and set as representing the trunk neural tube. A two-point calibration was performed using the newly shaken MQ (100% oxygen saturation) and by adding sodium dithionite to nonflowing MQ in the plate after measurements (0% oxygen saturation). Salinity of the tissue was determined using a conductivity meter (WTW 3110) and room temperature noted. The tissue is considered a liquid, where full oxygen saturation at 5‰ salinity and 25°C corresponds to 250 μm/L, 160 mmHg, or 21% atmospheric O2. Data were averaged for each HH stage including one measurement of the previous and subsequent HH stages. Replicates vary from 3 to 10 biologically independent data points. Data are presented as percent of maximum saturation in the solution of the specific temperature and salinity.

4.19 Quantifications

Embryonic development was quantified in two ways by determining the HH stage of embryos in ovo using head and tail morphology or by counting the number of somites of dissected embryos ex ovo. The number of embryos (n) for each group is denoted in respective figure legend. The fraction of proliferating EdU + cells was determined by quantifying the number of GFP + proliferating cells as well as RFP + construct targeted cells and dividing the number of double positive cells with the number of RFP + only cells. Premigratory and recently delaminated trunk neural crest cells were included (distinguished by the dotted line in figures). Quantification of migration was performed by calculating the area of detected HNK1 using the ImageJ software. The area of HNK1+ on the electroporated side of the embryos was normalized to that of the control side of the same embryo.

4.20 Statistical methods and data sets

One-way analysis of variance or two-sided student's unpaired t test was used for statistical analyses. For downstream analysis on the 97 DEGs where the software IPA was used, the statistical tests considered were P-value calculations using right-tailed Fisher exact test.


Kirish

In the early 20th century, after extensive studies of the ovine fetal circulation, Sir Joseph Barcroft (1872-1947) postulated that the environment in which the human fetus develops would be comparable to that likely endured by an adult on the summit of Mount Everest [1, 2]. He termed this intriguing hypothesis 'Everest bachadonda' and proposed that to survive the hypoxic uterine environ ment the fetus must develop elaborate physiological strategies comparable to those seen in climbers ascending the great Himalayan peaks.

In 2007, four climbers descending from the summit of Mount Everest (8,848 meters) took arterial blood gases from one another at 8,400 meters above sea level. Their mean arterial partial pressure of oxygen (PaO2) was 3.28 kPa (24.6 mm Hg) with a mean calculated arterial oxygen saturation (SaO2) of 54% while they rested without supplemental oxygen [3]. Among this group, one individual had a PaO2 of 2.55 kPa (19.1 mm Hg), the lowest PaO2 ever reported in an adult human. So how far removed from intrauterine life were these measurements, and do climbers exhibit, as does the fetus, physiological strategies that may benefit the similarly hypoxemic critically ill patient?


Nanoparticles for Targeting Intratumoral Hypoxia: Exploiting a Potential Weakness of Glioblastoma

Extensive hypoxic regions are the daunting hallmark of glioblastoma, as they host aggressive stem-like cells, hinder drug delivery and shield cancer cells from the effects of radiotherapy. Nanotechnology could address most of these issues, as it employs nanoparticles (NPs) carrying drugs that selectively accumulate and achieve controlled drug release in tumor tissues. Methods overcoming the stiff interstitium and scarce vascularity within hypoxic zones include the incorporation of collagenases to degrade the collagen-rich tumor extracellular matrix, the use of multistage systems that progressively reduce NP size or of NP-loaded cells that display inherent hypoxia-targeting abilities. The unfavorable hypoxia-induced low pH could be converted into a therapeutical advantage by pH-responsive NPs or multilayer NPs, while overexpressed markers of hypoxic cells could be specifically targeted for an enhanced preferential drug delivery. Finally, promising new gene therapeutics could also be incorporated into nanovehicles, which could lead to silencing of hypoxia-specific genes that are overexpressed in cancer cells. In this review, we highlight NPs which have shown promising results in targeting cancer hypoxia and we discuss their applicability in glioblastoma, as well as possible limitations. Novel research directions in this field are also considered.

Bu obuna tarkibini oldindan ko'rish, sizning muassasangiz orqali kirish.


Videoni tomosha qiling: 26-son 2020 Prostata bezi saraton xastaligining sabablari va davosiРак простаты причины заболевания (Dekabr 2021).