Ma `lumot

Drosophila kulrang / sariq


Men o'zim biologiya fanini o'rganyapman orqali Masofaviy ta'lim. Men bir muncha vaqtdan beri quyidagi muammoni hal qilishga harakat qildim va siz menga yordam bera olasiz deb umid qildim. Bu "uy vazifasi" bo'lgani uchun men yechimlardan ko'ra maslahatlarni qadrlayman.


Drosophila "sariq tana" geniga ega, $y$, X xromosomasida. Boshqa, dominant, allel "kulrang tana", $y^+$. Ayollarning kulrang tanalarini erkak kulrang tanalar bilan kesib o'tishda biz 50% kulrang urg'ochi, 22% kulrang erkaklar va 28% sariq erkaklarni olamiz.

Ota-onalarning genotipi qanday?


Hozirgacha qilgan ishlarim:

Genotip bo'lishi kerak $Xy^+X?$ ayol uchun va $Xy^+Y$ erkak uchun. Ko'rib chiqilishi kerak bo'lgan ikkita holat mavjud: $?=y^+$ yoki $?=y$. Birinchisida biz olamiz $frac{3}{8}$ kulrang urg'ochi va $frac{1}{8}$ sariq urg'ochi va $frac{2}{8}$ har biri kulrang va sariq erkaklar; bu sariq urg'ochilardan tashqari to'g'ri ko'rinadi. Ikkinchisida biz ikki barobar ko'p sariq urg'ochi olamiz.

Ehtimol, XXyy (sariq urg'ochi) genotipi o'limga olib keladi, lekin bu ota-onalarning genotiplarini aniqlashda yordam bermaydi.

Agar $? = y$ keyin dan o'tish $Xy^+mathbf{Xy} ; x ; mathbf{Xy^+}Y$ sariq urg'ochilarni yo'q qilmaydi.

Men e'tiborga olish kerak bo'lgan boshqa effektlarni bilmayman, shuning uchun men qotib qoldim.

$ $

Agar siz manbalarni taklif qilmoqchi bo'lsangiz (veb-saytlar, darsliklar $ldots$) ushbu mavzuga yoki umuman bu darajadagi biologiyaga tegishli bo'lsa, men buni juda qadrlayman.

Rahmat.


Tahrirlash: Men shunga o'xshash muammoga duch kelganlar uchun rasm qo'shmoqchiman.


Drosophila insonlar bilan bir xil jinsiy xromosomalar tizimiga ega bo'lganligi sababli (XY erkaklar va XX ayollar). Jinsni aniqlash muhimligi aniq - hech qanday urg'ochi sariq tanaga ega emas. Bu asosiy kuzatuv.

Erkaklar orasida sizda taxminan 50%/50% Y/y fenotipi mavjud. Bu jinsiy xromosoma bilan bog'liq bo'lgan klassik xususiyatga o'xshaydi. Bu yordam beradimi? Men oldinga borishim mumkin, lekin bu sizni u erga olib kelishi kerak.


Letal genlar: ma'nosi va turlari | Genetika

Barcha genlar yoki genetik omillar organizm uchun foydali emasligi kuzatildi. Har qanday organizmda mavjud bo'lsa, rivojlanishning dastlabki bosqichida uning o'limiga olib keladigan ba'zi genetik omillar yoki genlar mavjud. Ular hatto gomozigotli dominant yoki gomozigotli retsessiv holatda ham odamning o'limiga olib kelishi mumkin.

Frantsuz genetiki L. Kuenot (1905) sichqon tanasi rangining merosxo'rligi haqida xabar berdi. U “sariq” tana rangi oddiy “jigarrang” rangdan ustun ekanligini va bitta gen “Y” tomonidan boshqarilishini aniqladi. Sariq sichqonlarni homozigot holatda hech qachon olish mumkin emasligi kuzatildi.

Sariq qoplamali sichqonlar boshqa sariq qoplamali sichqonlar bilan kesishganda, sariq va jigarrang tana rangi uchun 2: 1 nisbatda ajratish olingan. Jigarrang shaxslar sof va homozigotli, sariq odamlar esa geterozigotali edi. Ushbu natijalarni sariq tana rangi uchun dominant allel gomozigotli holatda o'ldiradigan degan taxmin bilan izohlash mumkin.

(Sichqonlarda sariq qoplangan rangning irsiylanishi. Sariq qoplamali sichqonlar har doim geterozigotadir.)

E. Baur (1907) Snapdragon (Antirrhinum) da o'ldiradigan genni kuzatdi va uning barglari rang-barangligi bilan ajralib turishini aniqladi. “golden” o'z-o'zini tutish bo'yicha nav 3:1 o'rniga 2:1 nisbatda oltin va yashil 2 turdagi nasllarni beradi. Oltinlar geterozigotali, yashillari esa retsessiv gomozigotali.

O'ldiradigan genlarning turlari:

Lethel genlarini quyidagi guruhlarga bo'lish mumkin:

1. Resessiv halokatli:

O'limga olib keladigan genlarning aksariyati retsessiv o'limdir. U faqat gomozigotli holatda bo'lganida namoyon bo'ladi. Geterozigotalarning omon qolishi ta'sir qilmaydi, masalan, sichqonlarda palto rangi. Cuenot, Castle and Little ma'lumotlariga ko'ra, dominant allel Y retsessiv halokatli bo'lib, rivojlanishning dastlabki bosqichida gomozigotli YY embrionlarining o'limiga olib keladi.

2. Dominant halokatli:

Ba'zi o'limga olib keladigan genlar mavjud bo'lib, ular hatto geterozigotalarda ham hayotiylikni kamaytiradi, ular dominant o'limga olib keladi. masalan, odamda epiloiya geni. Bu aqliy nuqsonlarni, terining anormal o'sishini va geterozigotalarda o'smalarni keltirib chiqaradi, shuning uchun ular balog'atga etmasdan vafot etadilar. Dominant o'limga olib keladiganlar har bir avlodda mutatsiya orqali paydo bo'lishi mumkin.

3. Shartli halokatli:

O'limga olib keladigan genlar ularning o'ldiradigan ta'siri uchun aniq yoki o'ziga xos shartni talab qiladi, shartli o'ldiradiganlar deyiladi. Arpa, makkajo'xori, Neurospora, Drosophila va boshqa ko'plab organizmlarning ko'plab mutantlari haroratga sezgir mutatsiyalar deb ataladi. Ularning har biri o'zlarining halokatli harakatlarini ifodalash uchun aniq, odatda yuqori haroratga muhtoj.

Arpaning xlorofil mutantligi 19 ° C va undan yuqori haroratda normal xlorofill rivojlanishiga imkon beradi, lekin u 8 ° C dan past haroratda albina yoki g'ayritabiiy oq ko'chatlarni rivojlantiradi. Harorat nafaqat shartli o'limga olib kelishi uchun javobgardir. Ba'zi shartli o'ldiradiganlar yorug'lik, ovqatlanish va boshqalarni talab qiladi.

O'z-o'zidan doimiy zaxiradagi ikki xil o'lim o'rtasidagi muvozanat ta'siri muvozanatli o'ldiradigan tizim deb ataladi - Myuller (1918). Bog'lanishning repulsiya bosqichida bog'langan o'ldiradigan genlar muvozanatli o'lim deb ataladi. Ular qattiq bog'lanish tufayli itarilish bosqichida saqlanadi. O'tish juda past. Repulsiya bosqichida bir genning retsessiv alleli va boshqa genning dominant alleli bir xil xromosomada mavjud.

Ushbu muvozanatli letallar uchun geterozigotali shaxslar o'rtasida juftlashish 4 turdagi zigotalarni hosil qiladi. 1/4 qismi retsessiv letal uchun homozigot bo'ladi va omon qolmaydi. Zigotalarning yana 1/4 qismi boshqa retsessiv o'lim uchun homozigot bo'ladi va o'ladi.

Omon qoladigan yagona nasl 2 retsessiv letal uchun geterozigotlar bo'ladi. Shuning uchun muvozanatli o'ldiradigan tizim o'ldiradigan genlar bilan chambarchas bog'langan genlarni doimiy heterozigot holatida saqlaydi. Muvozanatli o'lim sichqonlarida, Oenothra, Drosophila va boshqalarda kuzatiladi.

(2 retsessiv halokatli genga ega bo'lgan muvozanatli halokatli tizim (l1 va l2 ). 4 geterozigotadan faqat 2 tasi omon qoladi (l1L2/L1l2)

Ba'zi genlar gametalarni urug'lanishga qodir emas. Bunday genlar gametik o'lim deb ataladi. Ba'zida ‘Meiotic drive’ atamasi gametik o'ldiradiganlarni tasvirlash uchun ishlatiladi. Meiotik qo'zg'alish geterozigota tomonidan teng bo'lmagan funktsional gametalarni ishlab chiqarishga olib keladigan mexanizm deb atash mumkin.

U Drosophila psevdoobscuraning ba'zi erkaklarida topilgan, oddiy erkaklarnikiga qaraganda sperma miqdorining atigi yarmini ishlab chiqaradi. Bu erkaklar oddiy urg'ochilar bilan juftlashganda, naslning aksariyati urg'ochi bo'ladi. Bu shuni ko'rsatadiki, bu erkaklar tomonidan ishlab chiqarilgan sperma hujayralari faqat ‘X’ xromosomasini o'z ichiga oladi va ularning ‘Y’xromosomaga ega bo'lgan spermatozoidlari ishlamaydi.

Bunga quyidagicha aniqlik kiritish mumkin:

Omon qolish ta'siriga ko'ra genlarni 5 sinfga bo'lish mumkin:


Genetikaning aloqasi: xususiyatlari, misollari, turlari va ahamiyati

Ota-onalarning ikki yoki undan ortiq belgilari bir necha avlod avlodlariga, masalan, F1, F2, F3 va hokazolar hech qanday rekombinatsiyasiz, ular bog'langan belgilar, hodisa esa bog'lanish deb ataladi.

Bu mustaqil assortimentning Mendel printsipidan og'ishdir.

Mendelning mustaqil assortiment qonuni alohida xromosomalarda joylashgan genlarga nisbatan qo'llaniladi. Turli belgilar uchun genlar bir xil xromosomada joylashgan bo'lsa, ular bir-biriga bog'langan va bog'langan deb ataladi.

Ular avlod tomonidan birgalikda meros bo'lib, mustaqil ravishda assortimentga olinmaydi. Shunday qilib, bir xil xromosomaning ikki yoki undan ortiq genlarining irsiyat jarayonida birga qolish tendentsiyasi bog'lanish deyiladi. Bateson va Punnet (1906) shirin no‘xat (Lathyrus odoratus) bilan ishlaganda gulning rangi va gulchang shakli bir joyda qolishini va Mendelning mustaqil assortiment qonuniga muvofiq mustaqil ravishda assortimentga ega emasligini kuzatgan.

Shirin no'xatning ikki xil navi - biri qizil gulli va dumaloq gulchangli, ikkinchisi ko'k gulli va uzun gulchangli donasi kesishganida, F.1 o'simliklar uzun gulchanglar bilan ko'k gulli edi (ko'k uzun belgilar mos ravishda qizil va yumaloq belgilarda ustunlik qilgan). Ushbu ko'k uzun (heterozigot) duragaylar juft retsessiv qizil va yumaloq (homozigot) shaxslar (test xoch) bilan kesishganda, ular F da kutilgan 1: 1: 1: 1 nisbatni hosil qila olmadilar.2 avlod. Ular aslida 7 : 1 : 1 : 7 (7 ko'k uzun: 1 ko'k dumaloq: 1 qizil uzun: 7 qizil dumaloq) nisbatida to'rtta kombinatsiyani hosil qildi (5.6-rasm).

Sinov xochining yuqoridagi natijasi aniq ko'rsatib turibdiki, ota-ona kombinatsiyalari (ko'k, uzun va qizil, dumaloq) ota-ona bo'lmagan kombinatsiyalarga qaraganda etti marta ko'p. Bateson va Punnet bir ota-onadan (BBLL × bbll) keladigan genlar (masalan, B va L) bir xil gametaga kirishga va birgalikda meros bo'lib o'tishga (birlashish) moyilligini taklif qildilar. Xuddi shunday, ikki xil ota-onadan (masalan, BBLL x bbll) kelgan genlar (B va 1) turli gametalarga kirib, alohida va mustaqil ravishda meros bo'lib o'tadi (repulsiya).

Morganning aloqaga qarashi:

Morgan (1910) Drosophila ustida ishlayotganda, ulanish va itarish bog'lanishning ikki jihati ekanligini ta'kidladi. U bog'lanishni bir xil xromosomada mavjud bo'lgan genlarning asl birikmasida qolish va bir gametaga birga kirish tendentsiyasi deb ta'riflagan.

Bir xil xromosomada joylashgan va birgalikda meros bo'lib o'tadigan genlar bog'langan genlar deb nomlanadi va ular tomonidan boshqariladigan belgilar bog'langan belgilar deb nomlanadi. Ularning rekombinatsiya chastotasi har doim 50% dan kam. Bitta xromosomada joylashgan barcha genlar bitta bog'lanish guruhini tashkil qiladi. Organizmdagi bog'lanish guruhining umumiy soni xromosoma juftlari soniga to'g'ri keladi. Masalan, odamda 23 ta, shirin no'xatda 7 ta va Drosophila melanogasterda 4 ta bog'lanish guruhi mavjud.

Bog'lanish nazariyasining xususiyatlari:

Morgan va Castl ‘Bog'lanishning xromosoma nazariyasi’.

U quyidagi asosiy xususiyatlarga ega:

1. Bog'lanishni ko'rsatadigan genlar bir xil xromosomada joylashgan.

2. Genlar xromosomada chiziqli tarzda joylashtirilgan, ya'ni genlarning bog'lanishi chiziqli.

3. Bog'langan genlar orasidagi masofa bog'lanish kuchiga teskari proportsionaldir. Bir-biriga yaqin joylashgan genlar kuchli bog'lanishni ko'rsatadi, keng tarqalgan bo'lganlar esa kesishish orqali ajralish ehtimoli ko'proq (zaif bog'lanish).

4. Bog'langan genlar meros davomida asl kombinatsiyasida qoladi.

5. Bog'langan genlar xromosomada ikki xil joylashuvni ko'rsatadi. Ikki yoki undan ortiq juft bog'langan genlarning dominant allellari bir xromosomada va ularning hammasining retsessiv allellari boshqa homologda (AB/ab) bo'lsa, bu joylashuv sis-arranglanish deb nomlanadi. Ammo, agar bir juftlikning dominant alleli va ikkinchi juftning retsessiv alleli bir xromosomada, ikkinchi juftlik xromosomasida esa retsessiv va dominant allellar (Ab/aB) bo‘lsa, bu joylashuv trans joylashuvi deyiladi (5.7-rasm). .

Bog'lanishga misollar:

Makkajo'xori bog'lanishning yaxshi namunasini beradi. Xatchinson rangli va toʻliq urugʻli (CCSS) makkajoʻxori navlarini rangsiz va toʻgʻralgan urugʻli (ccss) navi bilan kesib oʻtdi. Rang uchun C geni uning rangsiz alleli c ustidan, to'liq urug'lik uchun S geni esa qisqargan allel s ustidan dominantdir. Barcha F1 o'simliklar rangli va to'liq urug'larni hosil qildi. Ammo sinov xochida, bunday F1 urgʻochi (geterozigota) urugʻlari rangsiz va siqilgan (ikki retsessiv) oʻsimlik gulchanglari bilan oʻzaro changlanadi, toʻrt xil urugʻ hosil boʻladi (5.8-rasm).

Yuqorida ko'rsatilgan natijadan ko'rinib turibdiki, ota-ona birikmalari yangi kombinatsiyaga (3,6%) qaraganda ko'proq (96,4%). Bu ota-ona belgilarining bir-biriga bog'langanligini aniq ko'rsatadi. Ularning genlari bir xil xromosomada joylashgan va faqat 3,6% shaxslarda bu genlar krossingover orqali ajratiladi. Bu to'liq bo'lmagan bog'lanishning misolidir.

Morgan (1911) kulrang tanasi va uzun qanotli oddiy yovvoyi tipdagi drozofilani (BB VV) qora tanli va vastigial qanotli (bbvv) boshqa Drosophila (mutant tip) bilan kesib o'tdi. F.dagi barcha duragaylar1 avlod kulrang tanali va uzun qanotli (BbVv), ya'ni fenotipik jihatdan ota-onalarning yovvoyi turiga o'xshaydi. Agar endi F ning erkak avlodi (Bb Vv) tanasi qora tanli va vestigial qanotli (bbvv) qo'sh retsessiv urg'ochi (test xoch) bilan orqaga kesilsa, Fda faqat ota-ona birikmalari hosil bo'ladi.2 har qanday yangi kombinatsiyalar paydo bo'lmasdan avlod. Natijalar shuni ko'rsatadiki, kulrang tana xarakteri uzun qanotlari bilan birga meros bo'lib o'tadi.

Bu genlar bir-biriga bog'langanligini anglatadi. Xuddi shunday, qora tanli belgi vestigial qanot bilan bog'liq. F. avlodlarida faqat ota-ona xarakterlarining kombinatsiyasi paydo bo'lganligi sababli2 avlod va yangi yoki ota-onalik bo'lmagan kombinatsiyalar ko'rinmaydi, bu to'liq bog'liqlikni ko'rsatadi. To'liq bog'lanish Drosophila erkaklarida kuzatiladi.

Bog'lanish turlari:

Yangi kombinatsiyalar yoki ota-onaga tegishli bo'lmagan birikmalarning mavjudligi yoki yo'qligiga qarab, bog'lanish ikki xil bo'lishi mumkin:

Ikki yoki undan ortiq belgilar birgalikda meros bo'lib, ikki yoki undan ortiq avlodda o'zlarining asl yoki ota-ona birikmalarida doimiy ravishda paydo bo'lsa, bu to'liq bog'lanish deb ataladi. Bu genlar ota-onadan bo'lmagan birikmalarni hosil qilmaydi.

To'liq bog'lanishni ko'rsatadigan genlar bir xil xromosomada yaqin joylashgan. Erkak drozofilaning kulrang tanasi va uzun qanotlari uchun genlar to'liq bog'liqlikni ko'rsatadi.

(ii) Tugallanmagan aloqa:

To'liq bo'lmagan bog'liqlik ota-onaga tegishli bo'lmagan birikmalarning ma'lum foizini hosil qiluvchi genlar tomonidan namoyon bo'ladi. Bunday genlar xromosomada uzoqda joylashgan. Bu krossingover paytida xromosoma segmentlarining tasodifiy yoki vaqti-vaqti bilan sinishi bilan bog'liq.

Bog'lanishning ahamiyati:

(i) Bog'lanish duragaylash va tanlash dasturlari ko'lamini aniqlashda muhim rol o'ynaydi.

(ii) Bog'lanish genlarning rekombinatsiyasi ehtimolini kamaytiradi va shu bilan ota-onalarning xususiyatlarini birgalikda saqlashga yordam beradi. Shunday qilib, u organizmga ota-onalik, irqiy va boshqa belgilarni saqlab qolishga yordam beradi. Shu sababli o'simlik va hayvon zotlari turli xil belgilarni birlashtirishga qiynaladi.


Monitoring va boshqarish

Erkak va urg'ochi chivinlarni fermentlangan yoki oziqlantiruvchi moddalar bilan o'ljalangan tuzoqlarda tutish mumkin. SWD monitoringi uchun tuzoqlarni plastik deli stakanlardan yoki boshqa idishlardan osongina yasash mumkin. Tuzoqlarni qanday qurish haqida videolar NC State universiteti va Oregon shtat universiteti tomonidan ishlab chiqarilgan. Tuzoq dizayni va o'lja aralashmalarini sinovdan o'tkazish davom etmoqda, ammo arzon uy qurilishi tuzoqlari eng ko'p qo'llaniladi. Dastlab kuzatuv tuzoqlari olma sirkasi bilan o'ldirildi, ammo xamirturush va shakar o'ljalari va boshqa o'lja va o'ljalar chivinlarni sirkadan oldinroq tutishi isbotlangan. Xamirturush va shakar yemlari 2 osh qoshiq xamirturush va 4 osh qoshiq shakar va 32 oz suvni birlashtirib, atala hosil qiladi. Sariq yopishqoq kartochkalar tuzoqqa tushishni ko'paytirishi shart emas va SWD identifikatsiyasini qiyinlashtirishi mumkin. Tuzoqlar kamida haftada bir marta tekshirilishi kerak.

SWD tuzoq xamirturush va shakar atala bilan o'ljalangan. Surat: Xanna Burrak[/caption]

SWD infestatsiyasining oldini olish uchun davolash usullari tijorat ishlab chiqaruvchilari uchun tavsiya etiladi, chunki sotiladigan mevalarda SWDga tolerantlik yo'q. Janubiy mintaqadagi kichik mevalar konsortsiumi har yili yangilanadigan IPM qo'llanmalarini ishlab chiqaradi, ular mintaqaviy tavsiyalarni o'z ichiga oladi. Hududingiz uchun joriy tavsiyalar uchun mahalliy kengaytma xodimlari bilan maslahatlashing.


Oziq-ovqat va chorvachilik

Yovvoyi tabiatda meva chivinlari pishgan yoki chirigan mevalar ichidagi xamirturush, bakteriyalar va o'simlik moddalari bilan oziqlanadi. Laboratoriyada, Drosophila ommaviy axborot vositalari odatda turli xil uglevodlar va konservantlar bilan to'ldirilgan makkajo'xori uni/xamirturush/agar bazasidan iborat (retsept variantlari uchun http://flystocks.bio.indiana.edu/Fly_Work/media-recipes/media-recipes.htm ga qarang). Oziq-ovqatning qattiqligi shtammning sog'lig'iga va lichinka faolligi darajasiga qarab turli miqdorda agar bilan sozlanishi mumkin. Ingredientlar odatda suv bilan aralashtiriladi, qaynatiladi, flakonlarga yoki butilkalarga issiq quyiladi, so'ngra idishning pastki qismida qattiq oziq-ovqat vilkasini hosil qilish uchun sovutiladi. Savdoda mavjud bo'lgan ba'zi tez uchadigan ovqatlar (kartoshka bo'lagi bilan) oddiygina suv bilan bevosita madaniyat flakonida aralashtiriladi. Voyaga etgan pashshalar idishga (paxta yoki ko'pikli vilka bilan yopilgan) o'tkaziladi, u erda ular oziq-ovqat yuzasiga tuxum qo'yadi. Tuxumlardan lichinkalar paydo bo'lganda, lichinkalar oziq-ovqatga kirib, metamorfozga tayyor bo'lgunga qadar boshlang'ich bosqichlardan o'tadi. Uchinchi bosqichli lichinkalar "sayrayotgan" sifatida ular ovqatdan sudralib chiqib, idishning yon tomoni bo'ylab qo'g'irchoqlashadi. Hozirgi vaqtda kattalar chivinlari yoki lichinkalarini muzlatish va tiklashning samarali usullari mavjud emas, shuning uchun chivinlarni saqlashning odatiy usuli kattalar chivinlarini doimiy ravishda yangi muhitga o'tkazishdir. Pashshalar bakterial/mog'or bilan ifloslanmasligi va oqadilar to'planishiga yo'l qo'ymaslik uchun tez-tez (2-3 haftada bir marta) yangi oziq-ovqatga o'tkazish tavsiya etiladi, ammo bu vaqt odatda faol ishlatilmaydigan shtammlar uchun ularni 18 ° da ushlab turish orqali uzaytiriladi.


Muallif haqida ma'lumot

Aloqalar

Molekulyar, hujayra va rivojlanish biologiyasi kafedrasi, Kaliforniya universiteti, Los-Anjeles, Kaliforniya 90095, AQSH

Jivon Shim, Tina Mukerji va Utpal Banerji

Molekulyar biologiya instituti, Kaliforniya universiteti, Los-Anjeles, Kaliforniya 90095, AQSh

Biologik kimyo kafedrasi, Kaliforniya universiteti, Los-Anjeles, Kaliforniya 90095, AQSH

Eli va Edythe keng regenerativ tibbiyot va ildiz hujayra tadqiqotlari markazi, Kaliforniya universiteti, Los-Anjeles, Kaliforniya 90095, AQSh


Yordamchi ma'lumotlar

S1 ma'lumotlari. Raqamlar uchun raqamli qiymatlar.

Yorliqlar 2, 3 va 4-rasmlar va qo'llab-quvvatlovchi S2, S4, S5, S6 va S7 fayllari uchun raqamli qiymatlarni taqdim etadi.

S2 ma'lumotlari. Metagenomik kontigsiyalar.

Trinity [50] dan olingan xom metagenomik kontiglar, normallashtirilgan ma'lumotlarga ega Trinity va normallashtirilgan ma'lumotlarga ega Oazes [51] dan fasta formatida taqdim etiladi. Kontiglarning aksariyati kelib chiqishi mumkin Drosophila va tegishli mikrobiota. Kontiglar tozalanmagan va ximerik birikmalarni o'z ichiga olishi mumkin. Shunday qilib, ular Genbankga topshirish uchun mos emas va ularga ehtiyotkorlik bilan munosabatda bo'lish kerak.

S3 ma'lumotlari. Viruslarni moslashtirish.

1 va S3-rasmlarda keltirilgan daraxtlarni yaratish uchun ishlatiladigan oqsillar ketma-ketligini moslashtirish tahlillarni bajarish uchun ishlatiladigan MrBayes buyruqlari bilan bir qatorda nexus formatida taqdim etilgan.

S4 ma'lumotlari. Virus daraxti fayllari.

Bayesian posterior qo'llab-quvvatlanadigan maksimal ishonchlilik daraxtlari BEAST nexus formatida taqdim etilgan bo'lib, ular FigTree bilan namoyish qilish uchun mos keladi.

S5 ma'lumotlari. Ommaga ochiq RNK maʼlumotlar toʻplamida virusdan olingan oʻqishlar.

Yorliqlar bilan ajratilgan matn fayli 9 656 ommaviy mavjud ketma-ketlik "ishlash" ma'lumotlar to'plamidan virusdan olingan kichik RNK va RNK-seq o'qishlarini o'z ichiga oladi (2015 yil 9-mayda Yevropa nukleotidlar arxividan yuklab olingan). Har bir maʼlumot toʻplami uchun 2 milliongacha oʻqish (faqat oldinga oʻqish, agar ulangan boʻlsa) xaritaga tushirilgan. Xarita qilinadigan o'qishlari bo'lmagan ma'lumotlar to'plamlari chiqarib tashlandi.

S6 ma'lumotlari. Ommaviy o'qishlar yig'ilishida aniqlangan virusga o'xshash ketma-ketliklar.

Virusga o'xshash kontiglar hammaga ochiq bo'lganidan de novo yig'ildi D. melanogaster RNAseq ma'lumotlar to'plami (Genbankga taqdim etilmaydi), shu jumladan Brandeis virusi, Berkeley virusi, Totivirusga o'xshash ketma-ketlik va bir nechta reovirusga o'xshash ketma-ketliklar.

S7 ma'lumotlari. Populyatsiyani moslashtirish va BEAST fayllari.

Hizalamalar va BEAST modellari 6 va S13-rasmlar uchun BEAST xml sifatida.

S8 ma'lumotlari. Maksimal ishonchlilik daraxtlari.

6 va S7-rasmlar uchun BEAST chiqishining keyingi xulosalari (ikki mustaqil yugurish boʻyicha birgalikda xulosa qilingan).

S9 ma'lumotlari. FUBAR tahlili va chiqishi.

FUBAR (HyPhy) buyrug'ining ommaviy ish fayllari va chiqishi. Hizalamalar S7 ma'lumotlarida, daraxtlar esa S8 ma'lumotlarida keltirilgan.

S1-rasm. Xarita qilinadigan o'qish manbalari.

RNAseq va kichik (17-29nt) ulushi bu xaritani xarakterlash uchun o'qiydi D. melanogaster ko'chiriladigan elementlar, Drosophila miRNKlar, qolgan qismi D. melanogaster genom, Wolbachia va boshqa bakteriyalar, to'rtta "klassik" viruslar (DAV, DCV, DMelSV va Nora Virus), yangi nomlangan viruslar, boshqa BLAST nomzod viruslari va siRNK nomzod viruslari. Hisoblar xaritalanmagan o'qishni va o'qishni xaritalashni istisno qiladi Drosophila ribosomalar ketma-ketligi. EIKST metagenomik hovuzlar yoki ularning aralashmalariga ishora qiladi, "BGI" va "EG" sekvensiya Pekin Genomika Instituti yoki Edinburg Genomikasi (mos ravishda) tomonidan amalga oshirilganligini bildiradi, "HD" kichik RNK ketma-ketligi uchun "Yuqori aniqlikdagi" ligatsiya adapterlaridan foydalanishni bildiradi. , "RM" va "RZ" RiboMinus yoki Ribo-Zero tomonidan rRNK yo'qolishidan foydalanishni ko'rsatadi va "DSN" ikki qatorli nukleaza normalizatsiyasini bildiradi. Xom hisoblash ma'lumotlari S1 jadvalida keltirilgan.

S2-rasm qRT-PCR yordamida metagenomik hovuzlardagi viruslarning miqdorini aniqlash.

DCV, DAV, Nora virusi, DMelSV, Thika virusi, Motts Mill virusi, Torrey Pines virusi, Nyufild virusi, Tviford virusi, La Jolla virusi va E, I, K, beshta metagenomik hovuzning har birida mavjud bo'lgan Craigie's Hill virusi uchun RNK miqdorini aniqlash, ga nisbatan qRT-PCR bilan aniqlangan S va T Drosophila ribosoma oqsili geni RpL32. E'tibor bering, DCV va Twyford virusi bitta hovuzda aniqlanishi mumkin edi. Xato satrlari har bir namunaga ikki yoki uch nusxaga asoslangan va suyultirish seriyasidan (S2 matni) olingan samaradorlikni hisobga olgan holda vositalar uchun 80% ishonchlilik oralig'ini ifodalaydi. Virusning mavjudligi/yo'qligi kichik RNK ma'lumotlari bilan yaxshi mos keladi (S1-rasm), ammo bu virus hovuzlarida yuqori ketma-ketlik xilma-xilligini hisobga olgan holda qRT-PCR miqdorini aniqlash ishonchsiz bo'lishi mumkin. Xom KT ma'lumotlari S1 ma'lumotlarida berilgan.

S3 Fig. Qo'llab-quvvatlash va qo'shilish raqamlari bilan filogenetik daraxtlar.

Yangi va ilgari ma'lum bo'lgan o'rtasidagi taxminiy munosabatni ko'rsatadigan o'rta nuqtada ildiz otgan maksimal ishonchlilik daraxtlari Drosophila- bog'langan viruslar (qizil), boshqa taksonlardan ilgari nashr etilgan viruslar (qora) va Transkriptome Shotgun Assambleyalaridan olingan ketma-ketliklar (ko'k). Bayesian posterior qo'llab-quvvatlash ikkinchi darajali tugunlar uchun yuqorida va bo'sh joy ruxsat etilgan joylarda ko'rsatilgan va o'lchov har bir sayt uchun aminokislotalarni almashtirishda berilgan. Genbank nuklein kislotasi yoki oqsil identifikatorlari har bir ketma-ketlikdan keyin beriladi. (A) Craigie's Hill virusi va Nodaviruslar (B) Kilifi virusi, Thika virusi, DCV va Dicistroviruslar (C) Bloomfield virusi, Torrey Pines virusi va reoviruslar (D) Nyufild virusi, DAV va Permutotetraviruslar (E) Galbut virusi va TSA ketma-ketliklari (F) La Jolla Virus, Twyford Virus va yaqindan bog'liq Iflaviruslar (G) Motts Mill Virus, Sobemoviruslar va Poleroviruslar (H) Charvil Virus va Flaviviruslar (I) Dansoman Virus va Surunkali Bee Paralysis Virus (J) bilan bog'liq viruslar. Chaq virusi va TSA ketma-ketligi (K) Brandeis virusi va tegishli Negeviruslar (L) Berkeley virusi, DCV va Picornavirales ketma-ketliklari (M) Partitiviruslar (N) Bunyaviruslar (O) Kallithea virusi va nudiviruslar (esda tuting). D. innubila Nudivirus [56] bundan mustasno, chunki tegishli lokuslar mavjud emas). Hizalamalar S3 ma'lumotlarida va maksimal ishonchlilik daraxtlari S4 ma'lumotlarida taqdim etilgan.

S4-rasm. Kichik RNK o'lchamdagi taqsimotlarning takrorlanishi va asosiy tarkibi.

Chiziqlar 14 xil ketma-ketlik kutubxonalari (qatorlari) bo'ylab ajratilgan tanlangan viruslar (ustunlar) uchun kichik RNKlarning (17-29 nt) o'lchamlarini taqsimlashni ko'rsatadi. Barlar tepada chizilgan x-o'qi musbat chiziqqa o'qish xaritasini, quyida esa salbiy chiziqqa o'qish xaritasini ifodalaydi. Chiziqlar har bir 5′-asos (A-yashil, C-koʻk, G-sariq, U-qizil) bilan oʻqishlar nisbatiga koʻra ranglanadi. Har bir hovuzdagi har bir virus uchun taxminiy o'qishlar soni ko'rsatilgan va faqat ushbu hovuzda >100 kichik RNK o'qigan viruslar ko'rsatilgan. Juft qatorlar texnik nusxalarni ko'rsatadi va metagenomik hovuz (E, I, K, S, T) yoki hovuz aralashmasi bilan etiketlanadi. Aralash hovuzlar uchun (ko'k fon) pastki qatorlardagi o'qishlar Edinburgh Genomics tomonidan oksidlanish bosqichidan keyin (miRNK namoyishini kamaytirish uchun) va yuqori qatorlar oksidlanish bosqichisiz BGI tomonidan ketma-ketlashtirildi. Aralashtirilmagan hovuzlar uchun (oq fon) pastki qatorlardagi o'qishlar "Yuqori aniqlik" ligatsiya protokoli (ikkalasi ham oksidlanishsiz) yordamida ketma-ketlashtirildi. E'tibor bering, DCV, Nora virusi, Kilifi virusi va Thika virusida ko'rilgan uzoqroq (23-27 nt) o'qishlarning nisbiy soni, Kallithea miRNK o'qishlari soni kabi oksidlanish bosqichi borligida kamaygan ko'rinadi. Ushbu ko'rsatkich uchun xom ashyoni hisoblash ma'lumotlari S1 ma'lumotlarida keltirilgan.

S5 rasm. Pozitsiya bo'yicha kichik RNK asos tarkibi.

A qismi “ketma-ketlik logotipi” syujetlari virusdan kelib chiqqan kichik RNKlar uzunligi boʻylab asosli asos tarkibini koʻrsatadi, bunda nisbiy harf oʻlchamlari oʻsha pozitsiyadagi oʻqishlar orasidagi asosiy chastotani, umumiy balandlik esa axborot mazmunini ifodalaydi (bu maʼlumotlardan uzoqlashishni aniqlaydi). teng chastotalar). Har bir virus uchun faqat eng keng tarqalgan o'qish uzunligi ko'rsatiladi va o'qishlar barcha ketma-ketlik kutubxonalarida birlashtiriladi. E'tibor bering, ko'pgina viruslar 5 'bazasida A va U (T sifatida chizilgan) ga nisbatan kichik moyillikni ko'rsatadi, Twyford virusi esa 5' va 3' pozitsiyalarida U tomon yo'naltirilgan. Kallithea DNK virusi 22 nt o'qishda miRNA ATAGTTGTAGTGGCATTAATTG ustunlik qiladi. B qismidagi “ketma-ketlik logotipi” syujetlari Twyford virusidan (KP714075) 22 nt va 23 nt viRNKlarda viRNK-genom nomuvofiqliklari oʻrtasida asosli asosli tarkibni koʻrsatadi, bu 3′U qoldiqlarining koʻpchiligi shablonlanmaganligini koʻrsatadi. Ushbu ko'rsatkich uchun xom ashyoni hisoblash ma'lumotlari S1 ma'lumotlarida keltirilgan.

S6-rasm siRNK nomzod viruslari uchun kichik RNK hajmi va asosiy tarkibi.

Chiziqli diagrammalar kichik RNK o'lchovlari > gt80 bo'lgan nomsiz siRNK-nomzod lokuslari uchun kichik RNKlarning (17-29 nt) o'lchamlari taqsimotini ko'rsatadi. Inset - barcha kutubxonalar bo'ylab yig'ilgan kichik RNK o'qishlarining umumiy soni. Barlar tepada chizilgan x-o'qi musbat chiziqqa o'qishni ko'rsatishni va uning ostidagi chiziqlarni ifodalaydi x-eksa manfiy chiziqqa o'qish xaritasini ifodalaydi. Barlar har bir 5′-tayanch (A-yashil, C-koʻk, G-sariq, U-qizil) bilan oʻqishlar nisbatiga koʻra ranglanadi. Hammasi 21 nt cho‘qqisiga chiqadi va kutilgan 5′-asos tarkibini ko‘rsatadi (G ga nisbatan bir oz moyillik), siRNA nomzodi 14 (KP757950) bundan mustasno, bu Twyford virusida (KP714075) kuzatilgan 22–23 nt 5′ U ga boy cho‘qqini ko‘rsatadi. . Hisob ma'lumotlari S1 ma'lumotlarida taqdim etiladi.

S7 rasm Nisbatan kichik RNK ishlab chiqarish.

Turli viruslardan kichik RNKlar hosil bo'lish tezligidagi farqlarni aniqlash uchun biz ST va EIK metagenomik sekvensiya hovuzlarida 16 xil virusning har biri uchun nisbiy viRNK ishlab chiqarishni hisoblab chiqdik. Chiziqlar har bir virusga mos keladigan 21-23 nt kichik RNKlarning nisbiy soni o'rtasidagi nisbatni ko'rsatadi (ko'p sonli o'qishlar soni bo'yicha normallashtirilgan). Drosophila miRNK miR-34-5p) va virus RNK-seq o'qishlar soni (virusli bo'lmagan RNK seq o'qishlariga nisbatan, rRNK o'qishlari bundan mustasno). Nisbiy stavkalarni berish uchun nisbatlar eng past darajaga (EIK namunasidagi Kilifi virusi) normallashtirildi, shunday qilib Kilifi virusiga qaraganda DMelSV dan 10 4 baravar ko'proq viRNK olinadi. Viruslar EIK va ST hovuzlarida mavjud bo'lsa, ikkala ma'lumotlar to'plami o'rtasidagi korrelyatsiya yuqori (darajali korrelyatsiya koeffitsienti >0,99), bu o'zgarish takrorlanishi mumkinligini ko'rsatadi. Normallashtirilgan ma'lumotlar S1 ma'lumotlarida taqdim etiladi.

S8-rasm. RNK ma'lumotlar to'plamida virus tarqalishi.

To‘r 3144 ta ommaviy mavjud RNAseq va kichik RNK ma’lumotlar to‘plamining har biridan o‘qishlar nisbatini ko‘rsatadi. Drosophila va Drosophila viruslar (gorizontal o'q) bilan taqqoslaydigan hujayra madaniyati (vertikal o'q). Faqat million umumiy oʻqish uchun ≥100 virusli oʻqishda kamida bitta virus mavjud boʻlgan maʼlumotlar toʻplamlari kiritilgan va faqat kamida bitta maʼlumotlar toʻplamida ≥100 virusli oʻqish soniga ega boʻlgan viruslar kiritilgan. E'tibor bering, segmentlangan viruslarning turli qismlari odatda ma'lumotlar to'plamida birgalikda uchraydi, bu bizga siRNK-nomzod ketma-ketligini BLAST-nomzod ketma-ketliklari (masalan, Nodaviruslar va Bloomfield virusi) bilan vaqtincha bog'lash imkonini berdi. DAV dan viruslar Drosophila melanogaster Birnavirus haqida avval xabar berilgan, qolganlari bu yerda yangi tasvirlangan. Hisoblar S5 ma'lumotlarida keltirilgan.

S9-rasm. Virusning keng tarqalgan bo'ylab tarqalishi Drosophila hujayra madaniyati.

Keng qo'llaniladigan 26 tasining har biri uchun bitta namunali RNAseq ma'lumotlar to'plami tanlangan Drosophila hujayra madaniyati chiziqlari va barcha oldinga o'qishlar viruslar bilan taqqoslandi. Ma'lumotlar to'plamining 24 tasi ModEncode hujayra madaniyati ketma-ketligidan olingan [82] va mavjud bo'lmagan ikkitasi (OSS va Kc167) SRR070269 va SRR500470 ma'lumotlar to'plamlaridan olingan. Ranglar shkalasi kelib chiqishi virusli boʻlgan oʻqishlar ulushini koʻrsatadi (jami million oʻqishga virus oʻqishi) va viruslar virusli oʻqish qismi boʻyicha oʻsish tartibida tartiblangan (<1% virusli ML-DmD32 dan, ML-DmBG1-c1 gacha taxminan 50% virusli o'qishlar). E'tibor bering, virus populyatsiyasi turli subkulturalar orasida farq qilishi mumkin va bu qiymatlar faqat tasviriy ko'rib chiqilishi kerak. Hisoblar S5 ma'lumotlarida keltirilgan.

S10 Shakl. Aholi bo'yicha virus tarqalishi.

Grafiklarda virus va Wolbachia ichida tarqalishi D. melanogaster va D. simulanlar pashshalar yig'ilgan 17 ta joyning har biri uchun. Qiymatlar 2 log-ehtimollik oralig'i bilan maksimal ehtimollik taxminlari bo'lib, jurnallar shkalasida chizilgan. Hech qanday chiziq yoki ishonch oralig'i ta'minlanmagan bo'lsa, bu turdagi pashshalardan namuna olinmagan. Joylashuv tafsilotlari va aholining tarqalishi S4 jadvalida keltirilgan.

S11-rasm. Ko'p infektsiya va koinfektsiya tezligi.

Panellar (A) va (B) ning foizini ko'rsatadi D. melanogaster va D. simulanlar tekshirilgan viruslardan kamida bittasini tashuvchisi. Barlar 2 log-ehtimollik oralig'i bilan maksimal ehtimollik taxminidir. Rangli chiziqlar DAV, DCV, Nora, DMelSV, Twyford, La Jolla, Kallithea, Dansoman, Torrey Pines, Craigie's Hill, Thika, Newfield, Bloomfield yoki Motts Mill viruslari tashuvchilarni ifodalaydi (lekin yuqori tarqalgan siRNA nomzod viruslari bundan mustasno) kulrang chiziqlar, agar siRNK-nomzod viruslari (Galbut Virus va Chaq Virus) kiritilgan bo'lsa, umumiy tarqalishning katta o'sishini ko'rsatadi. Yo'qolgan chiziqlar xost turining yig'ish joyida yo'qligini ko'rsatadi (to'plash tafsilotlari va tarqalishi uchun S4 jadvaliga qarang). Panellar (C) va (E) virusdan xoli va ko'payib yuqtirilganlar nisbatini ko'rsatadi D. melanogaster Galbut virusi va Chaq virusi chiqarib tashlanganda (C) yoki kiritilganda (E), (D) va (F) esa ularning ekvivalent chizmalarini ko'rsatadi. D. simulanlar. Panellar (C-F) faqat bir martalik tahlillar yordamida hisoblab chiqiladi (ommaviy emas) va populyatsiyalar bo'yicha o'rtacha ko'rsatkichlar.

S12 rasm. O'rtasidagi bog'liqlik Wolbachia va viruslarning tarqalishi.

Har bir syujet nomidagi virus va o'rtasidagi bog'liqlikni ko'rsatadi Wolbachia tarqalganligi bo'yicha, tanlangan populyatsiyalar bo'ylab. Kiritilgan darajali korrelyatsiya koeffitsientlari va oddiy chiziqli regressiya (virus

Wolbachia) tasvir uchun. Tahlil keng tarqalganlikda hech qanday fazoviy avtokorrelyatsiyani hisobga olmaydi va bir nechta testlarni tuzatmaydi. Nuqtalar joylashuvi bo‘yicha ranglanadi (ranglar uchun S10 va S11-shakllarga qarang) va 2 log-ehtimollik oralig‘i bilan chiziladi. Nominal "ahamiyati" da p < 0,05 yulduzcha yordamida ko'rsatilgan. Qiymatlar S4 jadvalida keltirilgan.

S13-rasm ning evolyutsion xossalari Drosophila viruslar.

Har bir panelda etarli ketma-ketlik ma'lumotlari mavjud bo'lgan o'n bitta RNK virusi uchun virus evolyutsiyasi parametrlari ko'rsatilgan. Panellar (A) mutatsiya tezligi, (B) eng so'nggi umumiy ajdod sanasi, (C) geografik mintaqalar orasidagi harakat oralig'i (materiklar va laboratoriya sifatida belgilanadi), (D) o'zaro almashish tezligi. D. melanogaster va D. simulanlar, va (E) sinonimlarning nisbiy nisbati (dS) va nosinonim (dN) almashtirish (dN-dS > 0 ijobiy tanlovni bildiradi). For panels A–D points are the median of the posterior sample and 95% credibility intervals, panel E shows the median and range across codons. For all viruses except DAV and Nora Virus, a strong prior was placed on mutation rate (Panel A, grey box), and mutation rates and MRCA dates were inferred separately for each alignment block. The underlying BEAST XML files (including alignments and model specifications) are provided, along with the resulting mcc tree files and summaries of posterior distributions, in S7 Data and S8 Data. The underlying FUBAR batch files and per-site parameter estimates are provided in S9 Data.

S14 Fig. dN/dS in DAV and Nora Virus.

Point estimates of dN/dS are shown for each codon in open reading frames of DAV and Nora Virus (ratios of the posterior estimates, not the posterior estimates of the ratios). Bar colours illustrate posterior support that the site is constrained (blue for strong support that dN < dS) or positively selected (red for strong support that dN > dS). Positions coloured grey have little support for either positive selection or constraint. The dashed horizontal line indicates neutrality (dN = dS), so that bars higher than this are candidate sites for positive selection. The solid horizontal line shows the mean of the dN/dS estimates for that open reading frame. dN/dS estimates greater than 3 have been truncated to 3 for clarity. FUBAR batch files and parameter estimates are provided in S9 Data.

S1 Table. Sources of all metagenomic reads.

Counts of raw metagenomic reads mapping to Drosophila, bacteria, and viruses.

S2 Table. Detailed description of new viruses.

Detailed descriptions of BLAST-candidate virus fragments and named siRNA-candidate viruses.

S3 Table. Potential binding sites for Kallithea Virus miRNA.

Potential miRNA binding sites in D. melanogaster 3′ UTRs predicted by miRanda, and Gene Ontology enrichment analyses for genes with a miRanda score >150.

S4 Table. Survey collection details, locations, and virus prevalence.

Collection data (sample sizes, city, country, latitude and longitude, date) and virus prevalence for each species at each location (maximum likelihood estimate with 2 log-likelihood confidence intervals, all rounded to two significant figures).

S1 Text. Evidence for a micro-RNA in Kallithea Virus.

Output from the software package mirDeep [76] showing the proposed pre-miRNA hairpin, read numbers, and predicted folding pattern and energy. Reads are summed across all small-RNA libraries.

S2 Text. PCR and qPCR primers and conditions.


Gene Linkage & Chromosome Maps

Thomas Hunt Morgan studied fruit flies and found that in some crosses, expected outcomes weren't happening. Further experiments confirmed that alleles located on the same chromosome are inherited together.

*Mendel's dihybrid cross AaBb x AaBb would not have yielded a 9:3:3:1 ratio if he had chosen alleles located on the same chromosomes.

A common cross used to demonstrate linkage groups is the cross of a heterozygote wild type vestigial wings/ black body with a recessive mutant.

The cross would look like this

vg+ vg bl+ bl x vg vg bl bl

It may be easier at this point to use the older notation for letters, where the cross would look like AaBb x aabb

There are two possible arrangements for the heterozygote (AaBb) in the above cross.

If the dominant alleles are on different chromosomes (Ab) then it is called TRANS
If the dominant alleles AB are on the same chromosome, it is called a CIS arrangement

Cross produces: 50% wild type / 50 % mutant

If no crossing over has occurred, the outcome will always be 1:1, however this is not what Thomas Hunt Morgan observed.

Kutilgan Kuzatilgan
Wild Type 50 33
Mutant 50 33
Vestigial Wings, Wild 0 17
Wild, Black Body 0 17

Question: How would you explain these results?

Answer: The two offspring that did not look like either parent are called recombinants. They are a result of CROSS-OVER which occurred during meiosis, the alleles switch position.

Using this methodology, the chromosomes of the fruit fly were mapped. Each MAP UNIT represents how far apart the alleles are on the chromosome, the number is based on how often crossing over occurs.

Chromosome 2 on Drosophila Melanogaster (fruit fly)

Amaliy savollar

1. A dumpy winged (dd) fruit fly with long aristae (AA) is crossed with a long winged (Dd) short aristae (aa). Show the cross and the phenotypic proportions.

2. A fruit fly with short legs (ll) and vestigial wings (ww) is crossed with one that is heterozygous for both traits. Assuming the dominant alleles are on separate chromosomes, show the cross and the expected phenotypic proportions.

3. In fruit flies, red eyes is a dominant allele located on the X chromosome. The recessive condition results in white eyes. The tan body trait is also X-linked and is dominant to yellow bodies. A female who is heterozygous both traits with the dominant alleles located on the same chromosome is crossed with a white eyed, yellow bodied male. Show the cross and the phenotypic proportions (Don't forget these traits are X-linked!)

In pea plants, flower color and pollen shape are located on the same chromosome. A plant with purple flowers and long pollen (AaBb) is crossed with one that is recessive for both traits (aabb).

The results are as follows:


a) Are the chromosomes of the AaBb parent in the cis or trans position? Sketch a punnett square showing the expected offspring.


Faoliyatlar

The following is a concise list of the genetics vocabulary and Drosophila notation used in this activity.

gen A unit of hereditary information consisting of DNA.

allel One of the alternative forms of a gene.

fenotip The traits of an organism that are expressed.

genotip The genetic makeup of an organism.

homozigot Having two identical alleles for a particular trait.

heterozigotli Having two different alleles for a particular trait.

dominant allele In a heterozygous condition, the allele that is expressed.

recessive allele In a heterozygous condition, the allele that is not expressed.

yovvoyi turi An individual having the normal phenotype that is, the phenotype generally found in a natural population of organisms.

mutant An individual having a phenotype that differs from the normal phenotype.

  • Wild type is designated with a “+” for any allele.
  • Mutations are designated by a letter or letters related to the phenotype of the mutation.
  • Recessively inherited mutations are written in lowercase letters.
  • Dominantly inherited mutations are capitalized.
  • X-linked mutations are written as superscripts to X chromosomes (e.g., X w ). The Y chromosomes are also listed for males.
  • A written genotype lists the two alleles separated by a slash (e.g., +/vg).
  • genetic inheritance
  • rivojlanish biologiyasi
  • human health problems (e.g., alcoholism)

  1. Have students open the student pages on their computers, or hand out hard copies.
  2. Project the image of the two wild-type flies (image “A”).
    • Have students read the text and answer the questions about the wild-type flies.
    • Lead a discussion about what they observed, then introduce the idea of fenotip.
    • Congratulate any students who realized the flies are male and female. Tell them that the fly with the darker pigmentation at the tip of its abdomen is the male.
  3. Project image “B,” a wild-type fly paired with a vestigial mutant. (Don’t tell them the name of the mutant fly until they have made their observations.)
    • Have students compare the two flies and fill out the description columns in their table.
    • Tell students that the phenotype of this fly is “vestigial” because of its stubby wings, and let them record that.
  4. Repeat #3 with each of the remaining sets of flies.

ESLATMA: the final mutant fly, white eyes, is an easy phenotype to see, but the inheritance pattern (X-linked) is best used with advanced students. For an introductory lesson, you may wish to skip this fly.

  • Remind students that, with a dominant mutation, an individual can have two possible genotypes.
  • If you include the white-eyed fly, students will need to be introduced to the concept of sex-linked characteristics, and they must consider the genotype of both male and female flies.

For nearly 100 years, the fruit fly Drosophila melanogaster has played a pivotal role in genetics and molecular biology research. In this activity, we have selected fly mutants with easily seen variations and used them as a springboard to help students learn about phenotype, genotype, and genetic inheritance patterns.

Male and female wild-type flies
The male and female differ somewhat in appearance. One difference that can be easily seen in the photomicrographs is that the male has darker pigmentation at the tip of its abdomen. (Other differences are that the tip of the male’s abdomen is rounded while the female’s is pointed, and males have “sex combs,” areas of dark bristles on their front legs that females don’t have. But it’s difficult to see these differences in the images.)

Phenotype and genotype
Fenotip, the physical trait, is determined by the genotip, or genetic makeup of the organism. Single-gene traits are determined by two alleles, one of which is inherited from the mother and the other from the father. A phenotype is a description, whereas the genotype is, in this case, a pair of alleles where each allele may be the same (homozygous, e.g., +/+, vg/vg), or different (heterozygous, e.g., +/vg Cy/+).

Inheritance patterns
When two copies of the same allele are required to express a particular phenotype, we say that the inheritance pattern for that trait is retsessiv. For example, the vestigial phenotype is recessively inherited. The genotype of a vestigial fly must be vg/vg. Other recessive mutants in this activity are eyeless and ebony. An example of a human trait that is likely inherited in a recessive fashion is that for widow’s peak (a person’s hairline coming to a point at the top of the forehead). When only one allele is required to express a trait, as is the case with the curly-winged mutation, its inheritance pattern is hukmron. The genotype of a curly-winged fly could be Cy/+ or Cy/Cy. An example of a dominantly inherited trait in humans is that for achondroplasia, a form of dwarfism.

Genotype of a wild-type fly
When we observe a fly that is wild type in appearance, and we’re considering its genotype, we don’t really know if it’s homozygous or heterozygous for a recessive mutation. It may carry one allele that is wild type, for example, for body color, and one that is recessive, for example, the ebony allele. Because ebony is inherited recessively, we know that the wild-type fly must have at least one allele that is wild type for body color. We could discover its genotype by doing a genetic cross with a recessive homozygote, in this example, an ebony fly. This idea is covered in the activity Genetic Crosses.

X-linked mutations
The white-eyed mutation was the first fly mutation discovered. Bu bir X bilan bog'langan, yoki sex-linked, mutation. As in humans, flies that carry two X chromosomes are female, and flies that carry one X and one Y are male. In fruit flies, the Y chromosome is structurally different from the X chromosome, and it doesn’t carry genes that are complementary to those on the X, so any gene that is on the X in a male will be expressed, while the regular rules of dominant and recessive inheritance apply to female flies because they carry two X chromosomes. A white-eyed male must have the white mutation on its single X chromosome. In a female fly, the white mutation is inherited recessively, so two copies of the white mutation are necessary to produce a white-eyed female.

Supported by a Science Education Partnership Award (SEPA) from the National Center for Research Resources, National Institutes of Health, va David and Lucile Packard Foundation.


Christine E. Gray, Ph.D.

Christine E. Gray, Ph.D., is a molecular geneticist with an interest in mechanisms of gene regulation and development. Much of her research involved the identification and initial characterization of a CTCF-like protein in both Aedes aegypti (the primary vector of both yellow fever and dengue fever) and Anopheles gambiae (the principal vector of malaria). CTCF is a well-known insulator binding protein in vertebrates, and its mosquito homologue may provide a useful means to increase the efficiency of the process used to make transgenic mosquitoes.

Transgenic mosquitoes are made for two key reasons: to learn more about key mosquito genes involved in the natural transmission of pathogens and to potentially create mosquito strains that are unable to transmit pathogens such as viruses, filarial worms and protozoans.

At St. Mary’s, Gray is working with an undergraduate MARC student to assess confirmed CTCF binding sites from Anopheles gambiae for insulator function in a cell culture assay. In a separate project, she is working with several undergraduates on a project to investigate the mechanism for a phenomenon known as cytoplasmic incompatibility (CI) in fruit flies (Drosophila). CI results when specific bacteria (Wolbachia) infect the tissues of insects. These bacteria are then passed very efficiently from mother to offspring, while uninfected females who mate with infected males are essentially sterile.

Gray hopes that greater understanding of this natural phenomenon might enable others to utilize Wolbachia as part of a strategy to reduce the ability of insect vectors of disease to transmit pathogens.

In 2015, she was recognized by the St. Mary’s University Alumni Association by receiving the Distinguished Faculty Award.


Videoni tomosha qiling: Online Developmental Biology: Introduction to Drosophila (Dekabr 2021).