Ma `lumot

ChIP-qPCR yoki ChIP-seqni talqin qilish

ChIP-qPCR yoki ChIP-seqni talqin qilish


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Menda juda asosiy savol bor. Q-PCR yoki sekvensiya bilan birgalikda ChIPni o'rganish, men genomik mintaqada ma'lum bir proteinning turli darajalarini ko'raman. Qanday qilib bizda protein darajasi har xil bo'lishi mumkinligini tushunolmayapman. Men mintaqadagi oqsilning bog'lanishi ikki valentli deb o'yladim - bu sodir bo'ladi yoki yo'q. Ammo, men tushunganimdek, biz mintaqaga bog'langan proteinning turli konsentratsiyasi/miqdoriga ega bo'lishimiz mumkinmi? Va agar shunday bo'lsa, qanday qilib ChIP-qPCR da biz nihoyat DNK bo'laklarini olamiz, shuning uchun bu bog'lanishni fragmentlar miqdoridan qanday o'lchashimiz mumkin?


Protein DNK bilan bog'lanadi ikki valentli emas. ChIP sizni qiziqtirgan protein bog'langan DNKni boyitadi, ammo bu protein genomning ma'lum joylarini boshqalarga qaraganda kuchliroq va tez-tez bog'lashi mumkin. Stoxiometrik effektlar, bog'lovchi motivlarning mustahkamligi kabi rol o'ynaydi.

Ba'zi oqsillar ma'lum bir ketma-ketlikka juda aniq bog'lanadi, lekin ularning aksariyati bog'lanish joylarida ba'zi degeneratsiyaga imkon beradi. Kuchli sayt bog'lanadi tez-tez (va shuning uchun ChIP davomida yuqori darajada boyitilgan) zaifroq saytga qaraganda. Faqat mavjudligi emas, balki bog'lanish chastotasi ChIP haqiqatda o'lchaydigan narsadir.


ChIP-seqga kirish

ChIP-seq - bu keyingi avlod sekvensiyasi yordamida oqsil va DNK o'rtasidagi jismoniy bog'lanish o'zaro ta'sirini so'roq qilish imkonini beruvchi ajoyib texnikadir. Ushbu maqolada men ChIPni qisqacha ko'rib chiqaman va ChIPni keyingi avlod sekvensiyasi bilan birlashtirgan xromatin immunoprecipitatsiya sekvensiyasi texnikasi (ChIP-seq) bilan tanishtiraman.


Kirish imkoniyatlari

1 yil davomida jurnalga to'liq kirish huquqiga ega bo'ling

Barcha narxlar NET narxlardir.
QQS keyinroq to‘lov vaqtida qo‘shiladi.
Soliqlarni hisoblash to'lov paytida yakunlanadi.

ReadCube-da cheklangan vaqt yoki maqolaga to'liq kirish huquqiga ega bo'ling.

Barcha narxlar NET narxlardir.


Protokol

QAYD: Hammasi Ksenop ish MRC Milliy Tibbiy Tadqiqotlar Instituti tomonidan 1986 yilda qabul qilingan Buyuk Britaniyaning Hayvonlar (Ilmiy protseduralar) qonuniga to'liq mos keladi.

1. Tayyorgarlik

ChIP tajribasi uchun zarur bo'lgan embrionlar sonini hisoblang (muhokamaga qarang).

RT da saqlanadigan quyidagi eritmalarni tayyorlang: EDTAsiz 500 ml 10x Mark’s Modified Ringers (MMR), pH 7,5 ga sozlangan va avtoklavda sterillangan (1 M NaCl, 20 mM KCl, 20 mM CaCl)2, 10 mM MgSO4, 50 mM HEPES pH 7,5) 10 , 1 ml SDS elutsiya buferi (50 mM Tris-HCl pH 8,0, 1 mM EDTA, 1% SDS) va 1 ml 5x DNK yuklash buferi (0,2% Orange Glyce, 30%, 60 mM EDTA pH 8.0).

4 ºC da saqlanadigan quyidagi eritmalarni tayyorlang: 50 ml HEG buferi (50 mM HEPES'KOH pH 7,5, 1 mM EDTA pH 8,0, 20% glitserin), 500 ml ekstraksiya tamponlari E15 KOEP (H-ES0MH). pH 7,5, 150 mM NaCl, 1 mM EDTA.10% glitserin, 0,5% Igepal CA-630, 0,25% Triton X-100), E2 (10 mM Tris-HCl pH 8,0, 150 mM NaCm0, . EGTA) va E3 (10 mM Tris-HCl pH 8,0, 150 mM NaCl, 1 mM EDTA, 1% Igepal CA-630, 0,25% Na-deoksixolat, 0,1% SDS), 500 ml RIPA buferi (50-) KOH pH 7,5, 500 mM LiCl, 1 mM EDTA, 1% Igepal CA-630, 0,7% Na-deoksixolat) va 50 ml TEN buferi (10 mM Tris-HCl pH 8,0, 1 mM EDTA, Na 15 C).

15 ml konussimon polistirol trubkasini 7 ml belgisida qirqib oling. Sonikatsiyaga uchragan yadroviy ekstraktlarni o'z ichiga olish uchun ushbu naychadan foydalaning.

Keyingi tahlil qilish uchun kamida 8 GB RAM va 500 GB bo'sh disk maydoni bo'lgan ko'p yadroli Unix uslubidagi operatsion kompyuterdan foydalaning. Koʻpchilik buyruq satrida qoʻllaniladigan quyidagi dasturlarni mahalliy sifatida oʻrnating: FastQC, Illumina CASAVA-1.8 sifat filtri, Bowtie 11 , SAMtools 12 , HOMER 13 , MACS2 14 , IGV 15,16 , Cluster3 17 , Java+ TreeView18BLAST, . va b2g4pipe 19. O'rnatish ko'rsatmalari va kompilyatorlar va uchinchi tomon dasturlari uchun talablarni tekshiring.

Qisqa NGS o'qishlarini moslashtirish uchun Bowtie indeksini yarating Ksenop genom. Misol uchun bu erda ko'rsatilgan X. tropicalis genom v7.1 (noyabr 2011), uni FASTA fayli sifatida yuklab olish mumkin (genome.fa) Xenbase ftp serveridan (/pub/Genomics/JGI). FASTA faylini quyidagi joyga ko'chiring indeks Bowtie pastki katalogi.

Quyidagi buyruq qatoridan foydalaning (bu erda so'rov belgisidan keyin >) hosil qilish xenTro7 indeks fayllari: > bowtie-build /path/to/bowtie/index/genome.fa xenTro7 > eksport BOWTIE_INDEXES=/path/to/bowtie/index/

Gen annotatsiya faylini (GTF) UCSC Genom brauzeridan yoki eng so'nggi genom versiyalari (genomes.nimr.mrc.ac.uk) uchun NIMR serveridagi oyna saytidan Tools/Table Browser orqali yuklab oling. HOMERni sozlash uchun genom FASTA fayli va GTF faylidan foydalaning Ksenop (masalan, X. tropicalis genom v7.1, -xenTro7 nomi).

Shu bilan bir qatorda, Xenopus genomining ba'zi eski versiyalari uchun oldindan tuzilgan HOMER paketlaridan foydalaning. > loadGenome.pl -name xenTro7 -org null -fasta /path/to/genome.fa -gtf path/to/genes.gtf

Genom izini yaratish (.genom fayli) indekslangan FASTA faylini yuklash orqali IGV genom brauzeri uchun (genome.fa bilan genome.fa.fai fayl bir xil papkada) va izoh fayli (genes.gtf). Genom iskala indeksini yarating (genome.fa.fai) Xenopus genomi uchun quyidagicha: > samtools faidx /path/to/genome.fa

Gen ontologiyasi (GO) atamalarini bir nechta model turlaridan (odam, sichqoncha, zebrafish, meva chivinlari va xamirturush) o'tkazish uchun BLAST+ dan foydalaning. Ksenop genlar quyidagicha:

Barcha kodlash ketma-ketligini (CDS) bitta FASTA fayli sifatida yuklab oling (cds.fa) UCSC Genom brauzeridan Asboblar/jadval brauzeri orqali va BLAST+ ni ortiqcha bo'lmagan oqsillarning oldindan formatlangan BLAST ma'lumotlar bazasi bilan yangilang (nr): > update_blastdb.pl nr

Kengaytirilgan qidiruv funksiyasi (http://www.ncbi.nlm.nih) orqali NCBI saytidan odam (txid9606), sichqonchani (txid10090), zebrafish (txid7955), meva chivinlari (txid7227) va xamirturush (txid4932) oqsillarini qidiring. gov/protein/advanced) va natijada olingan GI (ketma-ketlik identifikatori) ro'yxatini yuboring (sequence.gi.txt) kompyuterga.

Tayinlash Ksenop genlarni GI ro'yxatidagi eng o'xshash oqsillarga BLASTxni ma'lum bir kutish (E) qiymat chegarasi bilan bajarish orqali (bu erda 10 -20 ). Chiqish formati xml ekanligiga ishonch hosil qiling (-outfmt 5 -out blastx_results.xml). Vaqtni tejaydigan iplardan foydalaning (-mavzular_soni) mavjud kompyuter yadrolari soni bilan bog'liq. > blastx -db /path/to/nr -gilist /path/to/sequence.gi.txt -so'rov /path/to/cds.fa -baholash 1e-20 -outfmt 5 -out /path/to/blastx_results.xml -num_threads [# ta mavzu]

b2gPipe.properties faylini oching b2g4pipe matn muharriri bilan papkani oching va ma'lumotlar bazasi xususiyatlarini yangilang Dbacces.dbname=b2go_sep13 va Dbacces.dbhost=publicdb.blast2go.com. O'rnatish papkasidan b2g4pipe-ni ishga tushiring. > java Xmx1000m -cp *:ext/*: es.blast2go.prog.B2GAnnotPipe -in /path/to/blastx_results.xml -out natijalari/xenTro7 -prop b2gPipe.properties -v -annot QAYD: Bu dastur har bir BLAST zarbasi uchun GO shartlarini ajratib oladi va ularni tegishli Xenopus genlariga tayinlaydi (xenTro7.annot). Eng yangilangan maʼlumotlar bazasi sozlamalarini Blast2GO Java Web Start ilovasining Asboblar/Umumiy sozlamalar/DataAccess sozlamalari boʻlimida topish mumkin (9.11.1-ga qarang).

2. Xromatinning o‘zaro bog‘lanishi

Urug'lantirish Ksenop standart protokollar 20 ko'ra tuxum, de-jelly va madaniyat embrionlari.

Yo'qolgan embrionlarni o'tkazing (maksimal 2500 X. laevis yoki 10 000 X. tropicalis) rivojlanish bosqichida 8 ml hajmli qopqoqli shisha namunali flakonga soling va ularni bir marta 0,01x MMR bilan qisqacha yuving.

Embrionlarni 0,01x MMRda 1% formaldegid bilan mahkamlang (masalan.225 µl 36,5-38% formaldegidni 8 ml 0,01x MMR) RT da 15 dan 40 minutgacha qo'shing (fiksatsiya vaqti va ChIP tajribasi uchun zarur bo'lgan embrionlar sonini muhokama qilish bo'limiga qarang). QAYD: Formaldegid korroziy va juda zaharli hisoblanadi. Ko'z va teriga tegsa, ovqat hazm qilish va nafas olish uchun xavflidir. Flakonga formaldegid qo'shganda tutun qopqog'idan foydalaning.

Embrionlarni sovuq 0,01x MMR bilan uch marta qisqa yuvish orqali fiksatsiyani to'xtating. Embriyaga yo'l qo'ymangos suyuqlik yuzasi bilan aloqa qiling, chunki sirt tarangligi ularning yorilishiga olib keladi.

Embrionlarni muz ustidagi 2 ml mikrotsentrifuga naychalariga ajrating, har bir kolbada maksimal 250 ta embrion bo'lib, ular taxminan 250 ½ l hajmni egallaydi (X. tropicalis) yoki 600 µl (X. laevis) tuxumdan chiqishdan oldin.

Iloji boricha 0,01x MMRni pipetka bilan olib tashlang. Agar darhol 3-bo'lim bilan davom etsangiz, keyingi bosqichni o'tkazib yuboring.

250 µl sovuq HEG buferida embrionlarni muvozanatlashtiring. Embrionlar kolba tubiga joylashib olgandan so'ng, iloji boricha ko'proq suyuqlikni olib tashlang va suyuq azotda muzlatib qo'ying. -80 ºC da saqlang.

3. Xromatin ekstraktsiyasi

QAYD: O'zaro bog'langan xromatinning quyidagi ekstraktsiyasi Ksenop embrionlar 2.3-bosqichda va 50 dan 80 gacha bo'lgan fiksatsiya vaqtlari bilan eng samarali ishlaydi. X. tropicalis yoki 25 dan 40 gacha X. laevis embrionlar E1, E2 va E3 ekstraksiya tamponining ml boshiga. Har bir ekstraksiya bosqichi takrorlanadi, shuning uchun hisoblangan bufer hajmi ikki baravar ko'p talab qilinadi. O'lchovni oshirish uchun bir nechta 2 ml mikrosentrifuga naychalari yoki 50 ml santrifüj naychalaridan foydalaning. Xromatin ekstraktsiyasi paytida namunalar va buferlarni muz ustida saqlang.

E1, E2 va E3 buferlarining etarli hajmini 1 mM DTT va proteaz inhibitori tabletkalari bilan to'ldiring. Agar ChIPni fosfoga xos antikor bilan bajarayotgan bo'lsangiz, buferlarni 5 mM NaF va 2 mM Na bilan to'ldiring.3VO4.

Ruxsat etilgan embrionlarni E1 bilan yuqoriga va pastga pipetlash orqali homogenlashtiring. Sovutgichli santrifugada (4 ºC) 1000 x g haroratda 2 minut davomida (yoki 50 ml naychalardan foydalanilganda 5 minut) santrifüj homogenlanadi. Supernatantni va devorga biriktirilgan lipidlarni aspiratsiya qiling.

E1 da pelletlarni qayta suspending. Namunalarni muz ustida 10 daqiqa ushlab turing. 3.2-bosqichdagi kabi santrifüj qiling va supernatantlarni tashlang.

E2 da pelletlarni qayta suspenziya qiling. 3.2-bosqichdagi kabi santrifüj qiling va supernatantlarni tashlang.

3.4-bosqichni takrorlang, lekin santrifüjdan oldin namunalarni muzda 10 daqiqa ushlab turing.

E3 da pelletlarni qayta suspenziya qiling. Namunalarni muz ustida kamida 10 daqiqa ushlab turing. 3.2-bosqichdagi kabi santrifüj qiling va supernatantlarni tashlang. QAYD: Ushbu bosqichda resuspenziyalar juda shaffof bo'lishi kerak. E3 tarkibidagi anionli yuvish vositalari qolgan sariq trombotsitlarning ko'p qismini eruvchan qilib, o'zaro bog'langan yadrolarni ajratib oladi.

Umumiy hajmi 1 ml E3 bo'lgan o'zaro bog'langan yadrolarning (odatda erigan pigment granulalaridan jigarrang rangga bo'yalgan) pelletlarini qayta suspenziya va birlashtiring. Namuna E3 bilan 2 yoki 3 ml gacha suyultiriladi, agar u juda yopishqoq bo'lib ko'rinsa va pipetka bilan o'tkazish qiyin bo'lsa. Xuddi shu yoki keyingi kuni 4-bosqichga o'tish uchun muz ustida yoki 4 ºC da saqlang. Suyuq azotda tezda muzlatib qo'ying va keyinroq ishlatish uchun ≥0221280 °C da saqlang.

4. Xromatinning parchalanishi

QAYD: Sonication o'zaro bog'langan kromatinni eritish va kesish uchun ham ishlatiladi. Bu erda 1/16 dyuymli konusli mikrotip va ovoz muhofazasi bilan jihozlangan Misonix Sonicator 3000-ni ishga tushirish parametrlari keltirilgan. Agar boshqa sonikatorlardan foydalansangiz, ishlab chiqaruvchilarning o'zaro bog'langan kromatinni kesish bo'yicha tavsiyalariga amal qiling yoki jami 4 dan 8 minutgacha 6 dan 12 Vtgacha foydalaning.

Yadro namunasini 3.7-bosqichdan sonikatsiya uchun maxsus qurilgan naychaga o'tkazing (1.4-bosqich). Qisqa termometr qisqichi orqali muzli suv bilan to'ldirilgan 800 ml plastik stakanga trubka biriktirib, sonikatsiya paytida namunani sovutib turing.

Stakanni laboratoriya uyasiga joylashtiring. Jekni shunday sozlangki, sonikator mikrotipi namunaga tovush chuqurligining taxminan uchdan ikki qismigacha botiriladi va trubka devoriga tegmasdan markazlashtiriladi.

Namunani jami 7 daqiqa davomida sonikatsiya qiling, har 30 soniyada 1 daqiqa pauza bilan to'xtatiladi. Quvvatni 1,0 ga o'rnating. Sonikatsiyani ishga tushiring va 9 dan 12 Vt gacha bo'lgan ko'rsatkichga erishish uchun quvvat sozlamalarini (odatda 2 dan 4 gacha) darhol oshiring. Namuna ko'piklana boshlasa, darhol pauza qiling. Naychaning joyini o'zgartiring va ko'pik butunlay yo'qolgach, qayta ishga tushiring.

Kesilgan xromatinni oldindan sovutilgan 1,5 ml mikrotsentrifuga naychalariga o'tkazing va to'liq tezlikda 5 daqiqa davomida 4 ºC da aylantiring.

Supernatantni oldindan sovutilgan 1,5 ml mikrotsentrifuga naychalariga o'tkazing. Xromatin parchalanish darajasini ko'rish uchun 50 ½ supernatant (ideal holda 400 000 yoki undan ortiq yadroli xromatinni o'z ichiga olgan) to'plang (5-bo'lim). ChIP uchun qolgan supernatantdan foydalaning (6-bo'lim).

Namunalarni 4 ºC haroratda bir kungacha saqlang. Suyuq azotda -80 ºC da uzoq muddatli saqlash uchun namunalarni alikvotlar sifatida muzlatib qo'ying (har bir ChIP tajribasida bitta).

5. Xromatin fragmentatsiyasini tasvirlash

4.6-bosqichdan boshlab 50 µ5l supernatantga 50 ½ SDS elutsiya buferi, 4 ½ 5 M NaCl va 1 ½ proteinaza K (20 ½ cg/μl) qo‘shing.

65 ºC ga o'rnatilgan gibridizatsiya pechida 6 dan 15 soatgacha (O/N) inkubatsiya qiling.

Tijoriy PCR tozalash to'plami yordamida DNKni tozalang. Agar kerak bo'lsa, ishlab chiqaruvchi tomonidan tavsiya etilgan pH ni sozlash uchun 3 M natriy asetatdan (pH 5,2) foydalaning. DNKni ikki marta 11 μl elyusiya buferi (10 mM Tris-HCl pH 8,5) bilan elute qiling.

Butun namunani 100 bp va 1 kb DNK zinapoyasi bilan 1,4% agaroz jelida ishlatishdan oldin 0,4 µl RNase A (20 μg/μl) va 5 µl 5x DNK yuklash buferini qo'shing. elektroforez. Optimal natijaga erishish uchun elektroforezdan keyin jelni xavfsiz nuklein kislota bo'yash eritmasi bilan bo'yash.

6. Xromatinning immunoprecipitatsiyasi

DIQQAT: Ushbu bo'limda magnit boncuklarni 4 ºC da 5 daqiqa davomida yuvish uchun past ushlab turuvchi 1,5 ml mikrosentrifuga naychalari va har bir kolba uchun kamida 1 ml ko'rsatilgan buferdan foydalaning. Boncuklardan tamponni olishdan oldin, har safar 20-30 soniya davomida yoki eritma shaffof bo'lguncha naychalarni magnit tokchada qoldiring.

4.6-bosqichdan 10 dan 30 ½ gacha supernatantni (kesilgan xromatin) keyinroq kirish namunasi sifatida foydalanish uchun yangi naychaga o'tkazing, bu ChIP uchun ishlatiladigan umumiy xromatinning taxminan 1% ga to'g'ri keladi. ChIP namunalari o'zaro bog'lanishlarni qaytarish uchun tayyor bo'lgunga qadar 4 ºC haroratda saqlang.

Qolgan xromatinni yangi naychaga o'tkazing. Antikor nazoratini talab qiladigan ChIP-qPCR tajribalari uchun ikkita naychaga teng hajmdagi xromatinni taqsimlang.

Xromatinga ChIP darajasidagi antikorni (yoki mos keladigan antikor nazoratini) qo'shing. Taxminiy qo'llanma sifatida, qiziqish epitopini ifodalovchi bir million hujayra uchun taxminan 1 µg antikordan foydalaning.

ChIP tajribasi uchun zarur bo'lgan antikor miqdorini aniqroq baholash uchun bir xil ChIPni turli miqdordagi antikorlar bilan ishlating (masalan., 0,25 µg, 1 µg va 2,5 µg) va ChIP-qPCR bo'yicha manfiy va musbat nazorat lokuslaridagi rentabellikni solishtiring (10-bo'limga qarang). Antikor nazorati sifatida antikor sifatida bir xil izotip va xost hayvon turlarining normal sarumidan foydalaning.

Rotatorda inkubatsiya qiling (10 rpm) O/Nꃚ 4ଌ.

Antikorga mos keladigan magnit boncuklarning etarli miqdorini bir marta E3 bilan 5 daqiqa davomida 4 ºC da yuving. Boncuklarning antikorlarni bog'lash qobiliyatini ishlab chiqaruvchining spetsifikatsiyasini tekshiring (odatda 5 dan 20 µl boncuklar 1 µg IgG antikorini bog'laydi).

Antikor oldindan inkubatsiya qilingan kromatinga yuvilgan boncuklar qo'shing. Yana rotatorda (10 rpm) 4 soat davomida inkubatsiya qiling.

Boncuklarni to'rt marta (ChIP-qPCR) yoki o'n marta (ChIP-Seq) oldindan sovutilgan RIPA buferi va keyin bir marta oldindan sovutilgan TEN buferi bilan yuving.

Bu qadamni faqat ChIP-Seq tajribasini bajarayotganda bajaring.

Yuvilgan boncuklarni har bir kolbaga 50 µl TEN buferiga soling. Bitta ChIP tajribasidan barcha boncuklarni bitta yangi naychaga o'tkazish orqali birlashtiring. Naychaning pastki qismidagi boncuklar to'plash uchun magnit tokchadan va 1000 x g da sovutilgan (4 ºC) santrifüjdan foydalaning. Boncuk peletini buzmasdan iloji boricha ko'proq suyuqlikni tashlang.

50 dan 100 º5 l gacha SDS elutsiya buferiga boncuklarni qayta suspenziya qilish va ularni termomikser (1000 rpm) bilan 65 ºC da 15 daqiqa davomida doimiy ravishda vortekslash orqali boncuklardan ChIP materialini olib tashlang. Shundan so'ng, 30 soniya davomida to'liq tezlikda (㸕,000 x g) santrifüj qiling. Supernatantni (ChIP eluat) yangi naychaga o'tkazing.

Oxirgi bosqichni takrorlang va ChIP eluatlarini birlashtiring.

7. Xromatinni teskari o'zaro bog'lash va DNKni tozalash

Kirish namunasiga (6.1-bosqich) 100 dan 200 µl gacha bo'lgan ChIP namunasi hajmiga erishish uchun etarli SDS elutsiya buferini qo'shing (6.10-bosqich). ChIP va kirish namunalarini 1/20 hajmdagi 5 M NaCl bilan to'ldiring. Namunalarni gibridizatsiya pechida 6 dan 15 soatgacha (O/N) 65 ºC da inkubatsiya qiling.

200 µg/ml da 1 hajmli TE buferi va RNase A qo'shing. 1 soat davomida 37 ºC da inkubatsiya qiling.

Proteinaz K ni 200 ± 5 g/ml ga qo'shing. 55 ºC da 2 dan 4 soatgacha inkubatsiya qiling.

DNKni fenol:xloroform:izoamil spirti ekstraktsiyasi bilan tozalang, so'ngra avval aytib o'tilganidek, etanol cho'kmasi 9 . ChIP-Seq uchun DNK pelletini eritish uchun 32 µl elyusiya buferi (10 mM Tris-HCl, pH 8,5) qo'shing. DNK butunlay eriganligiga ishonch hosil qilish uchun namunalarni muz ustida 30 daqiqaga qoldiring. QAYD: Tijoriy PCR tozalash to'plamlari DNKni qayta tiklash darajasi pastroq, lekin qulayroq va ChIP-qPCR namunalari uchun ishlatilishi mumkin.

ChIP-Seq uchun 1 µl ChIP konsentratsiyasini aniqlang va florometriyaga asoslangan usullardan foydalangan holda DNKni kiriting. Ishlab chiqaruvchining ko'rsatmalariga rioya qiling va DNK kontsentratsiyasi florometrning ishonchli aniqlash diapazoniga to'g'ri kelishiga ishonch hosil qiling.

8. ChIP-Seq kutubxonasini qurish va tekshirish

QAYD: DNK kutubxonasini tayyorlashning joriy usullari NGS uchun 1 dan 2 ng gacha bo'lgan yuqori murakkablikdagi kutubxonalarni qurish imkonini beradi. Murakkablik hisobiga kutubxonalar 50 pg DNK dan tayyorlanishi mumkin (Maxsus materiallar/uskunalar jadvaliga qarang). ChIP va kirish kutubxonasi uchun bir xil miqdordagi DNKdan foydalaning. Qisqacha aytganda, indekslangan (juftlangan) ChIP-Seq kutubxonalarini yaratish uchun ChIP va kirish DNKsi oxirigacha ta'mirlanishi, maxsus adapterlarga bog'lanishi (Maxsus materiallar/uskunalar jadvaliga qarang), o'lchami tanlanishi va PCR kuchaytirilishi kerak.

ChIP-Seq kutubxonalarini yaratish uchun ishlab chiqaruvchining ko'rsatmalariga amal qiling. Qo'shimcha tavsiyalar uchun muhokamaga qarang.

Har bir kutubxonani 12 µl elyusiya buferida eluting va florometr yordamida har bir ChIP va kirish kutubxonasining 1 µl konsentratsiyasini aniqlang. 5 dan 25 ng/µl gacha bo'lgan konsentratsiyalarni kuting. Agar konsentratsiyalar 25 ng/µl dan yuqori bo'lsa, PCR sikllari sonini (18 sikldan kam) kamaytirishni ko'rib chiqing. QAYD: NGSning optimal natijalariga erishish uchun aniq miqdorni aniqlash muhim ahamiyatga ega. 18 PCR tsiklidan keyin 1 ng/µl dan past konsentratsiyali kutubxonalar ketma-ketlikda bo'lishi mumkin, lekin ko'pincha murakkabligi pastroqdir.

Fragment o'lchamini taqsimlashni aniqlash va chipga asoslangan kapillyar elektroforez orqali adapter dimerining ifloslanishini (taxminan 120 bp atrofida) tekshirish uchun 1 µl kutubxonadan foydalaning. Kutubxonada adapter dimerlari mavjud bo'lsa, qattiq fazani qayta tiklanadigan immobilizatsiya tozalashni 1: 1 (1,6: 1 o'rniga) munchoq-namuna nisbati bilan takrorlang.

Kutubxonani tayyorlashdan oldin va keyin shunga o'xshash DNK boyitish tendentsiyalari kuzatilganligini tekshirish uchun tasdiqlangan ijobiy va salbiy nazorat joylarida qPCR o'tkazing (10-bo'limga qarang). Sifat nazorati tasdiqlangan kutubxonalarni ketma-ketlik uchun topshiring.

9. Keyingi ketma-ketlikni tahlil qilish va ma'lumotlarni vizualizatsiya qilish

QAYD: Hozirgi kunda NGS ko'pincha ichki yoki tijorat tartiblash vositalari tomonidan amalga oshiriladi (ba'zi NGS ko'rsatmalari uchun muhokamaga qarang). Standart chiqish millionlab ketma-ket o'qishlarni saqlaydigan bitta yoki bir nechta gzip-siqilgan FASTQ fayllari (*.fastq.gz). Odatda, multiplekslangan o'qishlar allaqachon indeksiga ko'ra ajratiladi va har bir o'qishda ketma-ketlik identifikatori va har bir asosiy qo'ng'iroq uchun sifat nazorati balli (Illumina 1.8+ uchun Phred+33) mavjud. Ushbu yondashuv NGS ma'lumotlarini tahlil qilishning ko'p usullaridan faqat bittasi. O'quvchi quyidagi buyruq satrlaridan birortasi o'zgartirishni talab qiladimi yoki yo'qligini tekshirish tavsiya etiladi, chunki bu maydon tez rivojlanmoqda va yangilanishlar muntazam ravishda amalga oshiriladi.

Gzip-siqilgan FASTQ fayllarini birlashtiring va FastQC skriptidan foydalanib ketma-ketlik ma'lumotlarining sifatini tekshiring. Terminaldan ChIP va kirish ketma-ketligi ma'lumotlari (ChIP uchun ko'rsatilgan misollar) uchun ushbu va quyidagi buyruqlarning aksariyatini bajaring: > mushuk /path/to/*.fastq.gz > ChIP.fastq.gz > fastqc ChIP.fastq.gz QAYD: Yuqori murakkablikdagi ChIP-Seq kutubxonasining muvaffaqiyatli ketma-ketligidan olingan xom ma'lumotlar ko'p sinovlardan o'tishi kerak. Muvaffaqiyatsizliklar asosan noto'g'ri ketma-ketlik va eksperimental artefaktlardan kelib chiqadi, masalan, PCR kuchaytirilishi yoki adapterning ifloslanishi. Muayyan darajadagi takrorlanish (ortiqchalik) kutiladi, chunki ortiqcha o'qishlar ifodalanishi mumkin halollik bilan, insof bilan DNKni boyitish 21. Biroq, cho'qqilarni aniqlash sezgirligiga ta'sir qilmasdan, ortiqcha o'qishlarni yo'q qilish uchun keyinchalik o'qish teglarini - 5’ oxiri yoki o'qishni - har bir tayanch juftiga bitta bilan cheklash mumkin (9.4-bosqich) 21 .

Adapter ifloslanishini olib tashlash uchun ketma-ketlik ma'lumotlarini oldindan qayta ishlash (homerTools trim -3 kadaptor ketma-ketligi>) bitta nomuvofiqlikka ruxsat berish (-mis 1). (Indekslangan) adapterning dastlabki 20 ta asosini (5-3-gachasi) bog'langanda qiziqtiradigan DNK fragmentiga proksimaldan foydalaning (Maxsus materiallar/uskunalar jadvalida keltirilgan adapter uchun ko'rsatilgan). > gzip -cd ChIP.fastq.gz | fastq_illumina_filter -vN > ChIP.fastq > homerTools trim -3 GATCGGAAGAGCACACGTCT -mis 1 -min 36 ChIP.fastq QAYD: Filtrlangan o'qishlarni olib tashlash (-N) faqat Illumina 1.8 tomonidan yaratilgan FASTQ fayllarida sukut bo'yicha talab qilinadi. ni o'tkazib yuboring fastq_illumina_filtr buyruq (ya'ni., ‘| fastq_illumina_filter –vN’) agar 1.8 dan eski versiya ketma-ketlik identifikatorini yaratgan bo'lsa.

Oldindan ishlangan o'qishlarni mos yozuvlar genomiga moslang (xenTro7) Bowtie yordamida. Faqat noyob xaritalangan o'qishlarni saqlang (-m 1) standart sozlamalardan foydalangan holda, yaʼni dastlabki 28 ta asosdagi maksimal ikkita mos kelmaslik va oʻqish uchun barcha nomuvofiqliklarning umumiy Phred+33 sifat koʻrsatkichi maksimal 70. Hisobotni SAM formatida (-S) tekislash. Har bir mavzu uchun megabaytlar sonini oshiring (--chunkmbs) agar parcha xotirasi tugasa: > bowtie -m 1 -S -p [# ta mavzu] --chunkmbs [masalan. 200] xenTro7 ChIP.fastq.trimmed > ChIP.sam QAYD: Bowtie sukut bo'yicha Phred+33 sifat ko'rsatkichlarini kutadi. Variantni qo'shing -phred64-quals agar FASTQ fayli Illumina tomonidan 1,8 dan eski Phred+64 sifat ballari bilan yaratilgan bo'lsa.

Hizalama (SAM) faylini bigWig fayliga (.bw) aylantirish uchun ikkita HOMER buyrug'idan foydalaning: > makeTagDirectory ChIP/ -single -tbp 1 ChIP.sam > makeUCSCfile ChIP/ -bigWig /path/to/ genome.fa.fai -fsize 1e20 -norm 1e7 -o ChIP.bw QAYD: Transformatsiya iskala indeksini talab qiladi (genome.fa.fai) mos yozuvlar genomining (1.8-bosqich). Bu erda profil har bir asosiy juftlik uchun bitta teg bilan cheklangan (- osh qoshiq 1) va 10 million o'qishga normallashtirildi (- me'yor 1e7). bigWig IGV kabi genom brauzeri yordamida xromatin profillarini dinamik ravishda vizualizatsiya qilish uchun afzal qilingan formatlardan biridir (9.12-bosqich).

Teglarning taqsimlanishini aniqlang (-d Chip/) genomik belgilarda (masalan., +/- 10 kb 25 bp qutilari bilan, -size 20000 - tarix 25) kabi transkripsiya boshlanishi (tss, misol bu erda ko'rsatilgan) va tugatish (tts) saytlar. HOMER perl skriptini ishga tushiring annotatePeaks.pl bilan Ksenop izohlar xenTro7 (1.7-qadam): > annotatePeaks.pl tss xenTro7 -hajmi 20000 -hiss 25-d ChIP/ > ChIP_tagDensity.tss

ChIP o'rtasida DNK boyitishning muhim cho'qqilarini toping (-t ChIP.sam) va Kirish (-c Input.sam) ichida X. tropicalis 1% FDR chegarasi bilan MACS2 yordamida genom (-q 0,01) va DNK fragmentlari (sonikatsiyadan keyin) 200 bp (--bw=200) model yaratish uchun. Bayroqni qo'shing --keng Agar giston belgilari yoki RNK polimeraza kabi qiziqish uyg'otadigan xromatin xususiyatining keng tarqalishi kutilsa, ushbu buyruq qatoriga. > macs2 callpeak -t ChIP.sam -c Input.sam -f SAM -n ChIP -g 1,4376e9 -q 0,01 --bw=200 QAYD: ning samarali hajmi X. tropicalis genom yig'ilishi v7.1 taxminan 1,4376 milliard bp (-g 1,4376e9). MACS2 BED faylini (ChIP_peaks.bed) hosil qiladi va ularning genomik joylashuvi bilan cho'qqilarni oladi.

Klasterli issiqlik xaritasi ko'rinishidagi bir nechta xromatin profillarini solishtiring:

Qiziqarli teglar zichligi kataloglaridan teg tarqatish matritsasini yarating (-d ChIP/ other_ChIP/) MACS2 cho'qqilarida (masalan., +/- 1 kb, 25 bp qutilari bilan, - hajmi 2000 -his 25 -ghist): > annotatePeaks.pl ChIP_peaks.bed xenTro7 -siz 2000 -hist 25 -ghist -d ChIP/ other_ChIP/ > ChIP.matrix

Yuklash uchun Cluster3 ning grafik foydalanuvchi interfeysidan foydalaning ChIP.matritsa fayl va ierarxik ravishda ushbu teg zichligini eng yaqin markazga minimal Evklid masofasidan kelib chiqqan holda klasterlash. Yaratilgan CTD faylini Java TreeView-da klasterlashni vizualizatsiya qilish uchun oching.

Eng yuqori cho'qqilarda boyitilgan yangi va ilgari ma'lum bo'lgan bog'lash motivlarini toping +/- 100 bp (- o'lchami 200). AnnotatePeaks.pl dan motivlar paydo bo'lishini xaritalash va motiv zichligini chizish uchun foydalaning: > findMotifsGenome.pl ChIP_peaks.bed xenTro7 ChIP_motifs/ -size 200 -p [# threads] > annotatePeaks.pl ChIP_peaks.bed xenTro7 -m motif1.motif xenTro7 -m motif1.motif �. to'shak xenTro7 -m motif1.motif -o'lcham 800 -hist 25 > motif1.zichlik QAYD: The findMotifsGenome.pl skript boyitishni tasodifiy tanlangan gen-markazli fon ketma-ketliklari bilan taqqoslashdan chiqaradi. Eng boyitilgan roman motivi ostida saqlangan motif1.motif pozitsiya vazni matritsasi formatida. O'quvchiga ushbu natijalarni boshqalar bilan isbotlash tavsiya etiladi de novo cisFinder 22 va MEME 23 kabi motivlarni aniqlash usullari.

Eng yaqin gengacha bo'lgan masofani hisoblash va 400 bp oynalar ichida normallashtirilgan o'qish sonini aniqlash orqali cho'qqilarni izohlang (- hajmi 400): > annotatePeaks.pl ChIP_peaks.bed xenTro7 -o'lchami 400 -d ChIP/ Kirish/ > ChIP_peaks.genes

Raqamni ro'yxatga olish uchun quyidagi awk buyrug'i yordamida natijani jamlang (N.), joylashuv va individual o'qishning normallashtirilgan soni (R) va hammasi (LR) eng yaqin (maqsadli) gen uchun tepaliklar. > awk 'BEGIN < FS=' ' >$7 >= -5000 && $7 <= 1000 < N[$8]+=1 R[$8]+=$9 LR[ $8]=LR[$8]','$7'('$9')' >END< for(i in N) < print i ' ' N[i] ' ' R[i]' ' substr(LR[i],2)>>' ChIP_peaks.genes > ChIP_peaks.summary QAYD: keyingi raqam $ ga mos kelishi uchun o'zgartirish kerak bo'lishi mumkin bo'lgan ustun raqamiga ishora qiladi ChIP_peaks.genes oldingi bosqichda yaratilgan fayl. Ushbu skript namunasi TSSning yuqori oqimidagi 5 kb va quyi oqimidagi 1 kb dan ortiq cho'qqilarni filtrlaydi. $7, $8 va $9 mos ravishda TSS, gen identifikatori va har bir cho'qqi uchun normallashtirilgan o'qishlar soniga bo'lgan masofaga murojaat qiling.

Maqsadli genlar orasida boyitilgan GO atamalarini quyidagi tarzda tahlil qiling:

Blast2GO ning grafik foydalanuvchi interfeysini Java Web Start (javaws) 19 orqali buyruq satridan ishga tushiring. > javaws http://blast2go.com/webstart/blast2go1000.jnlp

Izoh faylini yuklash uchun ishlab chiquvchilarning ko'rsatmalariga amal qiling Ksenop genlar (xenTro7.annot) 1.9.4 da yaratilganidek va aniqlangan maqsadli genlarning tekis fayli. Ikkala faylda bir xil gen identifikatorlari ishlatilganligiga ishonch hosil qiling.

bigWig qo'shish orqali kromatin profillarini tasavvur qiling (ChIP.bw, Input.bw) va BED fayllari (ChIP_peaks.bed) treklar sifatida IGV ichiga. Rivojlanishning bir xil bosqichida mavjud bo'lsa, ma'lumotlarni RNK-Seq treklari bilan to'ldiring. Natijalarni sessiya sifatida saqlang.

Yuqorida yaratilgan ma'lumotlarni qayta ishlash va vizualizatsiya qilish uchun R (www.r-project.org) yoki MATLAB dasturlash platformalaridan foydalaning. Shu bilan bir qatorda, Excel yordamida kichik ma'lumotlar to'plamini tuzing.

10. ChIPni sinash va ChIP-seqni tasdiqlash uchun ChIP-qPCR

60 ºC (T) da taxminan 100 bp DNKni o'rab turgan primerlarni loyihalash uchun Primer3 onlayn platformasidan foydalaning.m) ham ijobiy (cho'qqisiga xos) va salbiy nazorat lokuslari uchun. dan foydalanib, primerning o'ziga xosligini tasdiqlang silika ichida UCSC Genom brauzerida PCR qidiruvi amalga oshirildi.

Taxminan 1% kiritishdan boshlab uch marta suyultirishning 8 nuqtali standart egri chizig'ini yarating yoki DNKni boyitish miqdorini aniqlash uchun 2 − Δ㥌(T) 8,24 usulidan foydalaning.

Barcha namunalar uchun texnik uch nusxada real vaqtda PCRni bajaring, ya'ni, ChIP, nazorat va agar kerak bo'lsa, standart egri namunalar.

DNKning boyitishini kiritilgan DNKning ulushi yoki ChIP va nazorat namunasiga nisbati sifatida musbat va manfiy nazorat nuqtalarida chizing.


Xromatin immunopresipitsiyasini o'rgatish qiymati

Bizning bepul onlayn treningimiz sizga ChIP tahlillarini o'zlashtirish uchun barcha zarur ma'lumotlarni taqdim etadi.

Ushbu treningni tugatganingizdan so'ng, siz quyidagilarni qila olasiz:

  • Xromatin immunoprecipitatsiyasining asosiy tamoyillarini tushuning
  • Sizni qiziqtirgan maqsad uchun to'g'ri ChIP protokolini tanlang
  • O'zaro bog'lanish va mahalliy ChIP protokollarini optimallashtiring va qo'llang
  • To'qima va o'simlik namunalaridan xromatinni ajratib oling
  • ChIP ma'lumotlarini tahlil qilish tamoyillarini tushuning
  • Onlayn vositalar yordamida ChIP-seq ma'lumotlaringizni sharhlang
  • Kam hujayralar soni bilan ChIP tajribasini o'tkazing
  • ChIP-dagi eng keng tarqalgan muammolarni bartaraf etish

Siz allaqachon ChIP tahlilini o'zlashtirganmisiz? Antikor asoslari, lyuminestsent tasvirlash, IHC, oqim sitometriyasi va western blot bo'yicha o'quv dasturlarimizni ko'rib chiqing.


Munozara

Ko'payib borayotgan dalillar qarish jarayonida [23, 43, 79] va neyrodegenerativ kasalliklar [22, 36, 48, 52, 59] patogenezida tuzatilmagan DNKning to'planishi uchun rolni qo'llab-quvvatlaydi. Bizning tadqiqotimiz IR ta'siriga uchragan kemiruvchilarning sog'lom miya yarim korteksi neyronlarida tuzatilmagan DNKning uzoq muddatli yadroviy bo'linishi va genomik lokalizatsiyasining birinchi tahlilini taqdim etadi. Bu erda biz kalamush va sichqoncha kortikal neyronlarida DSB ning IR orqali hosil bo'lishi xromatin bo'linmasi PDDF ning de novo shakllanishiga olib kelishini aniqladik [7, 50]. Biz PDDF neyronga xos tuzilmalar ekanligini ko'rsatamiz, bu ularning NeuN neyron markerini ifodalovchi perikariya [62] tipik neyron morfologiyasiga ega bo'lgan hujayralardagi eksklyuziv mavjudligi bilan ko'rsatilgan. PDDF ta'mirlash qiyin yoki uzoq muddatda tuzatib bo'lmaydigan doimiy DSBlar tufayli xromatin konformatsiyasi normal shikastlanishdan oldingi holatiga tiklana olmaydigan genomik hududlarni chegaralaydi [48, 79]. Astrotsitlar va mikrogliyalarda PDDF ning yo'qligi glial hujayralar nurlanishga chidamliroq yoki DNK shikastlanishini tiklash uchun samaraliroq ekanligini ko'rsatadi. Qizig'i shundaki, DNKning shikastlanishi bilan qo'zg'atilgan qarilikka o'xshash holat [22], hech bo'lmaganda ushbu tadqiqotda qo'llanilgan eksperimental sharoitlarda nurlanish paytida PDDF shakllanishi bilan bog'liq emas.

PDDF ning kortikal neyronlarda tashkil etilishi xuddi shunday eksperimental sharoitlarda periferik asab tizimining sensorli ganglion neyronlarida kuzatilganiga o'xshaydi [50]. Bu fakt sutemizuvchilarning markaziy va periferik neyronlari DDR ning o'xshash naqshini baham ko'rishini qat'iy qo'llab-quvvatlaydi, natijada ma'lum bir yadro bo'limida, PDDFda tuzatilmagan DNK to'planadi.

Ko'pgina kortikal neyronlarda PDDFlarning 15d post-IR da mavjudligi shuni ko'rsatadiki, ChIP-seq tahlili aniqlanganidek, turli xromosomalarning tuzatilmagan DNK ketma-ketliklari bir yoki ikkita ajratilgan xromatin bo'linmalarida to'planish uchun nisbatan katta masofadan o'tadi. Tirik sutemizuvchilar hujayralarida 53BP1 lyuminestsent yorliqli DNK ta'mirlash omilini kuzatish orqali IR-induktsiyalangan DSB joylarida xromatin harakatchanligi oshishi haqida ilgari xabar berilgan edi [38]. Shunga muvofiq, yaqinda olib borilgan ishlar 53BP1 zararlangan xromatinning harakatchanligini oshirishini aniqladi [81].

PDF bo'shashgan xromatin tolalaridan tashkil topgan dekompaklangan tuzilishga ega tozalangan xromatin domenlari sifatida paydo bo'ldi [39, 50]. Ushbu konfiguratsiya, ehtimol, DNK ta'mirlash omillariga shikastlangan DNKga yaxshiroq kirishni ta'minlaydi, bu PDDF ichidagi xromatin tolalarining 53BP1 immunogold belgilarida tavsiya etilgan. Qizig'i shundaki, PDDF ochiq xromatin tuzilishini namoyish etsa ham, bu genlarni ifodalashga imkon beradi, ular transkripsiyasiz yadro bo'linmalaridir. Shunday qilib, PDFDF-da transkripsiyani o'chirish shikastlangan genlar tomonidan kodlangan aberrant mRNK va oqsillarni ishlab chiqarishni oldini olish orqali neyronlarda genomik beqarorlikni kamaytirishga qaratilgan himoya neyronal mexanizm bo'lishi mumkin [50]. Shuni hisobga olish kerakki, neyronlar hujayraning omon qolishiga yordam berish uchun IR dan keyin 24 soat ichida ko'pgina DNK lezyonlarini tezda tuzatadi [7] va NHEJ DNKni tuzatish yo'li xatolarga moyil bo'lib, vaqti-vaqti bilan kichik o'chirish va mutatsiyalar hisobiga ishlaydi. transkripsiya xatolari [13, 27, 79]. Shunday qilib, PDDF ning himoya roliga qaramay, ushbu transkripsiya xatolari hujayra proteostazasiga ta'sir qilib, neyron disfunktsiyasiga olib kelishi mumkin [27].

Neyronlarning DNKning to'planishiga neyrodejeneratsiya va hujayra o'limini qo'zg'atmasdan qanday qilib toqat qilishini tushunish muhim vazifadir, ammo bir martalik IQ dozasi bilan qo'zg'atilgan ko'plab DSBlar [7, 50]. Bizning natijalarimiz shuni ko'rsatadiki, PDDF tuzatilmagan DNKni uzoq muddatli sekvestrlash uchun ixtisoslashgan yadro markazlari bo'lib, ular DNKning neyronal shikastlanishi/ta'mirlash signalini (gH2AX va 53BP1) saqlaydi va shikastlangan genlarning ifodalanishini oldini oladi. PDDF shikastlangan DNKni sekvestrlash orqali genomik yaxlitlikni himoya qilishga yordam beradi va buzilmagan xromatin transkripsiyasini oldini oladi, shuning uchun neyronlarning omon qolishiga hissa qo'shadi. Sutemizuvchilarning neyronlari diploid hujayralar [61] bo'lganligi sababli, PDDF tarkibidagi genomik hududlarda joylashgan genlarning transkripsiya blokadasi genning ikkinchi nusxasi ifodasi bilan qoplanishi mumkin. Aslida, bizning in situ transkripsiya tahlilimiz shuni ko'rsatadiki, transkripsiya shikastlanmagan evromatinda, shu jumladan PDF-ning yon tomonlarida saqlanadi.

Muhim masalalardan biri PDDF ning aniq belgilangan chegaralari bilan chegaralangan o'ziga xos strukturaviy, molekulyar va transkripsiyaviy xususiyatlari qanday o'rnatilganligini tushunishdir. Xromosoma konformatsiyasini ushlash texnikasi yordamida genom bo'ylab o'zaro ta'sir o'rganish shuni ko'rsatdiki, genom Topologik Associated Domenlarda (TAD) tashkil etilgan bo'lib, ular ichida kuchaytirgichlar va promotorlar o'zaro ta'sir qiladigan diskret tartibga soluvchi birliklarni tashkil qiladi [17, 55]. TADlar ko'pincha kohezin va CTCF ga ega bo'lgan chegara hududlari bilan ajratiladi [17]. CRISP/Cas9 genomini tahrirlash orqali CTCF bog'lanish joylarini buzish TAD chegaralarining izolyatsiyalash faolligini buzadi va transkripsiyaning o'zgarishiga olib keladigan kuchaytiruvchi-promoter o'zaro ta'sir profilidagi o'zgarishlarni keltirib chiqaradi [28, 46]. Bizning topilmalarimiz PDDF chegaralarida CTCF boyitilganligini, shuningdek uning yuqori oqimda aniqlangan gH2AX bog'lanish joyi bilan birgalikda lokalizatsiyasini ko'rsatadi. scn4a gen CTCF ning sog'lom va shikastlangan xromatin o'rtasidagi interfeysni aniqlashda kohezin kompleksi bilan hamkorlikdagi roliga ishora qiladi. Shu bilan kelishilgan holda, CTCF va kohezin bilan bog'langan xromatin halqa langarlari topoizomeraz 2B [5] tomonidan qo'zg'atilgan DSBlarga ayniqsa zaif ekanligi e'lon qilindi. Ushbu ma'lumotlar xromatin arxitekturasi va topologik stress o'rtasida tor bog'liqlik mavjudligini ko'rsatadi. Bundan tashqari, PDDF chegaralarida CTCF ning izolyatsiyalash funktsiyasi transkripsiyaviy repressiya va shikastlangan DNK ketma-ketligini faol klasterlash uchun zarur bo'lishi mumkin. Kortikal neyronlarda bu mexanizm apoptotik yo'llarni qo'zg'atmasdan izolyatsiya qilingan bo'linmada tuzatilmagan DNKning to'planishiga toqat qilishi mumkin. Ushbu g'oya boshqa uyali modelda o'tkazilgan tajribalar bilan qo'llab-quvvatlanadi, bu erda repressiv heterokromatin domenlarida joylashgan CTCF chegaralari kuchaytirgichlarni promouterlardan ajratib, transkripsiyani o'chiradi [64].

PDDF kortikal neyronlarning yadro hajmida tasodifiy taqsimlanmaydi, aksincha ular yadro bilan va kamroq darajada yadro periferiyasida joylashgan heterokromatin massalari bilan afzal fazoviy bog'lanishga ega. Ikkala lokalizatsiyada PDFDF repressiv yadro muhiti bilan chambarchas bog'liq [64]. Sutemizuvchilar neyronlarida bunday repressiv muhit yadro yuzasida va yadro periferiyasida sentromerik va telomerik geterokromatin domenlarining to'planishi natijasida hosil bo'ladi [2, 49]. Repressiyalangan geteroxromatin metillangan DNKni bog'lovchi MeCP2 oqsili va polikombli repressiv komplekslar (PRC1 va PRC2) kabi susturucu oqsillar bilan boyitilganligi aniqlangan, ularning bu pozitsiyalarda mavjudligi yaqin atrofdagi genlarni o'chirishi mumkin [2, 64]. In situ transkripsiya tahlilida aniqlanganidek, repressiv muhitga qo'shni PDFDFning lokalizatsiyasi shikastlangan genlarni tanlab o'chirishni osonlashtirishi mumkin, bu esa genomik barqarorlikni saqlashga yordam beradi. Bundan tashqari, bir nechta dalillar shuni ko'rsatadiki, yadroviy va geterokromatin DSBs euxromatin tomonidan tashkil etilgan qulayroq muhitni izlash uchun DNKni ta'mirlash uchun ikkala strukturaning periferiyasiga qarab harakatlanishi mumkin [12, 29, 35, 76]. Bu PDDF-larning ribosoma genlari va geterokromatin ketma-ketliklarining DNK ta'mirida ham ishtirok etishi ehtimolini oshiradi.

Ushbu tadqiqotning asosiy topilmasi kortikal neyronlardan PDDFda boyitilgan DNK ketma-ketligini genom bo'ylab identifikatsiya qilishdir. gH2AX ning PDDF ichidagi shikastlangan xromatin bilan o'ziga xos bog'lanishini hisobga olsak, bizning ChIP-seq signalimiz ushbu yadro bo'linmasi ichida joylashgan genomik hududlarga mos keladi deb taxmin qilamiz. Bizning ma'lumotimizga ko'ra, bu yadro o'choqlarida to'plangan neyronal ta'mirlanmagan DNKning genomik tarqalishini tavsiflovchi birinchi tadqiqotdir.Muhimi, bizning tahlilimiz shuni ko'rsatdiki, gH2AX nurlanmagan neyronlarda ma'lum genomik pozitsiyalarda allaqachon mavjud bo'lgan va nurlanish paytida uning darajasi mintaqalarga qarab 1,5 dan 7,5 barobargacha o'zgarib turadi. Bu kuzatuv kortikal neyronlardagi natijalarimiz (hozirgi tadqiqot) va sensorli ganglion neyronlarining oldingi ma'lumotlari bilan mos keladi [50], bu nurlanmagan neyronlarning taxminan 5 foizida PDDF borligini ko'rsatadi, bu yosh kattalardagi neyronlar uzoq vaqt davomida tuzatilmagan DNKni to'plashi mumkinligini ko'rsatadi. fiziologik sharoitda atama. Shunga asoslanib, biz xromatin domenlarida genomik tarqalishi tufayli DNKning shikastlanishiga ko'proq moyil bo'lgan yoki DNKni tiklashga ko'proq qarshilik ko'rsatadigan va ta'mirlanmagan DNKlari PDF-fayllarda to'plangan genlar to'plami bo'lishi mumkinligini tasavvur qilamiz. Ushbu gipoteza nurlangan miya yarim korteksining namunalarida kuzatilgan gH2AX ning yuqori darajalari bilan ko'rsatilgandek, ularning IQ ta'siriga nisbatan zaifligi kuchayishi bilan qo'llab-quvvatlanadi.

Neyronlar postmitotik hujayralar sifatida o'zlarining butun genomini ta'mirlashdan qochadi va ularning transkripsiyasi bilan bog'langan mexanizm orqali bir nechta genlarni tuzatishni cheklaydi [56, 57]. Ushbu genlarning transkripsiyasi neyronlarning omon qolishi uchun zarur bo'lgan trofik funktsiyalarni saqlash uchun muhimdir. Biroq, bizning natijalarimiz shuni ko'rsatadiki, protein kodlovchi genlarga yaqin joylashgan gH2AX ning aksariyati neyron gomeostazi uchun zarur bo'lgan hujayra yo'llariga mos keladi, masalan, neyrotransmissiya, sinaptik plastisiya va adezyon, pentoza fosfat yo'li yoki autofagiya-lizosomal yo'l. Bu shuni ko'rsatadiki, hech bo'lmaganda faol transkripsiyalangan genlar to'plami samarasiz ravishda tuzatilishi mumkin va PDF-da qolishi mumkin.

Qarish bilan bir qatorda, DNKning noto'g'ri ta'mirlanishi va DNKning bir vaqtning o'zida to'planishi bir qator neyrodegenerativ kasalliklar bilan bog'liq [13, 48, 52, 73]. Biroq, DNK shikastlanishining patogen mexanizmlarini tushunish nevropatologik sharoitlarda lezyonlarni to'plashga moyilligi yuqori bo'lgan genlarni aniqlashni talab qiladi. Asosiy muammo har bir neyrodegenerativ kasallikning rivojlanishi uchun zarur bo'lgan DNK lezyonlarini eksperimental hayvonlar modellaridan foydalangan holda aniqlashdir, bunda DNK shikastlanishining to'planishi qisman inson kasalligining patogenezini taqlid qiladi [48]. Shu munosabat bilan, bizning gH2AX ChIP-seq tahlilimiz nurlanmagan va nurlangan namunalarda yaqin atrofdagi DNK lezyonlari bo'lgan bir qator genlarni aniqlaydi va bu ularning shikastlanishga ko'proq moyil ekanligini ko'rsatadi. Ushbu genlarning ba'zilari OMIM va DisGeNET platformalarida insonning genetik kasalliklari bilan bog'liq bo'lib, nevrologik va neyropsikiyatrik kasalliklarga alohida e'tibor qaratilgan. Nevrologik kasalliklar bilan bog'liq bo'lganlar orasida, epm2a (Lafora kasalligi), serpini1 (neyroserpin inklyuziya organlari bilan oilali ensefalopatiya), il1rpl1 (Autizm va aqliy zaiflik X bilan bog'liq 21) va scn4a (giperkalemik peridok falaj), gen-kasallik juftligining "ishonchlilik balli" bilan ko'rsatilgan ushbu kasalliklardagi muhim roli bilan ayniqsa qiziq (1-jadval). Shunga asoslanib, bizning natijalarimiz zaif genlarni tiklashga to'sqinlik qiluvchi molekulyar mexanizmlarni o'rganishga qaratilgan nevrologik kasalliklarning to'g'ri genetik jihatdan o'zgartirilgan hayvonlar modellarini ishlab chiqish uchun istiqbolli imkoniyat ochadi deb hisoblaymiz.


Qiyosiy ChIP-seq (Comp-ChIP-seq): eksperimental loyihalash uchun amaliy qo'llanma va yangi hisoblash metodologiyasi

Xromatin immunoprecipitatsiyasi va undan so'ng yuqori o'tkazuvchanlik sekvensiyasi (ChIP-seq) xromatin bilan bog'langan omillarning funksionalligini tushunish va genomning funktsional elementlarini xaritalashning asosiy usuli hisoblanadi. Xromatin nishonlarining o'zaro ta'sir kuchidagi hujayra va kasalliklarga xos o'zgarishlarni baholash uchun bir nechta sharoitlarda ChIP-seq signali mustahkam normalizatsiya qilinishi kerak. Biroq, biologik va eksperimental o'zgaruvchanlikni nazorat qilish uchun ma'lumotnomasi yo'q standart ChIP-seq sxemasidan foydalanish mumkin emas. Yaqinda bir nechta tadqiqotlar ushbu muammoni chetlab o'tish uchun turli xil echimlarni taklif qilgan bo'lsa-da, metodologiyalar orasidagi jiddiy texnik va analitik farqlar eksperimental qayta ishlab chiqarishga to'sqinlik qilishi mumkin. Bu erda biz turli xil namunalar bo'yicha qiyosiy ChIP-seq uchun normalizatsiya usulini eksperimental ravishda amalga oshirish uchun amaliy ikkilik qaror qabul qilish jarayonini taqdim etamiz. Bundan tashqari, biz mos yozuvlar ichki genom yordamida normallashtirish uchun joriy hisoblash yondashuvlarini yonma-yon baholaymiz. Va nihoyat, biz ChIP-seq ma'lumotlarini genom bo'yicha aniq normallashtirish uchun mahalliy regressiya strategiyasini taklif qilamiz. Umuman olganda, qiyosiy ChIP-seq (Comp-ChIP-seq) uchun tavsiya etilgan eksperimental va hisoblash standartimiz eksperimental takrorlanuvchanlikni oshiradi va shu bilan ChIP-seq natijalarini sharhlashda ushbu asosiy chalkash omilni kamaytiradi.


NATIJALAR

Ma'lumotlarni ishlab chiqarish va sifat nazorati

PRC2 ulanishi sichqonchaning ES hujayralari, fibroblastlar, NP va saraton hujayralari qatorlari (5, 12-17, 21, 22, 39) kabi turli xil hujayra turlarida tasvirlangan. Qon hujayralarining differentsiatsiyasi paytida PRC2 rolini o'rganish uchun biz H3K27me3 va RNK polimeraza II (RNApol-II) G1ME (28) gemopoetik hujayra chizig'ida tarqalishini o'rganish uchun ChIP-seqdan foydalandik. PRC2 ning naslga xos funktsiyalari haqida tushunchaga ega bo'lish uchun biz sichqonchaning ES hujayralarida tarqalishini ham ko'rib chiqdik. ChIP namunalari va ikkita hujayra turidan kirish DNKsi ketma-ketlashtirilib, har bir holat uchun o'rtacha 8 million noyob xaritalangan o'qishni berdi (Qo'shimcha jadval S2). Bundan tashqari, biz ES hujayralari, NP hujayralari va MEFlarda H3K27me3, H3K4me3 va H3K36me3 uchun ilgari nashr etilgan ChIP-seq ma'lumotlar to'plamlaridan foydalandik (5) (Qo'shimcha jadval S2). Barcha o'qishlar bowtie (32) yordamida sichqon genomining mm9 versiyasi bilan taqqoslandi.

Dastlab, biz H3K27me3 ning ES hujayralarida tarqalishini ilgari nashr etilgan ma'lumotlar bilan solishtirish orqali ma'lumotlarimizning sifatini baholadik (5). Ikki tajriba o'rtasidagi genom bo'ylab 5 kb qutidagi o'qishlar soni xaritalangan o'qishlarning umumiy soni uchun normallashtirilgandan so'ng yuqori darajada bog'liqligini aniqladik ( P = 0.92, 1 A-rasm), bu ikki maʼlumot toʻplami oʻrtasidagi yaxshi muvofiqlikni koʻrsatadi. Bundan tashqari, biz FastQC ( http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/ ) yordamida yangi yaratilgan va hammaga ochiq ma'lumotlarimiz bo'yicha standart sifat nazorati ko'rsatkichlarini yaratdik. Bizning yangi ketma-ketlik texnologiyasi bilan ishlab chiqarilgan ma'lumotlarimiz doimiy ravishda yuqori sifatni ko'rsatdi (Qo'shimcha rasm S2). Oldingi tadqiqotlarga muvofiq, biz H3K27me3 ES hujayralarida ham, G1ME hujayralarida ham genik hududlarda yuqori darajada boyitilganligini aniqladik, umumiy o'qishlarning 41 va 45% genga to'g'ri keladi va bu hududlar genomning <2% ni tashkil etgan 3 kb promouter mintaqasiga to'g'ri keladi.

ES hujayralaridan H3K27me3 ChIP-seq ma'lumotlar to'plamlarini taqqoslash. ( A ) H3K27me3 ma'lumotlaridagi xaritalangan o'qishlar soni bizning ma'lumotlarimiz (WEHI) va ommaviy ma'lumotlar (Mikkelsen) uchun ES hujayralaridagi butun genom bo'ylab 5 kb oraliqda baholandi. Har bir intervaldagi o'qishlar soni jami xaritalangan o'qishlar nisbati sifatida ifodalangan. Ma'lumotlar jurnalga chizilgan 2 miqyosda va kuchli ijobiy korrelyatsiyani ko'rsatadi (Pirson korrelyatsiya koeffitsienti 0,92). ( B ) Turli qo'ng'iroq usullari (MACS yoki Poisson) yordamida bizning ma'lumotlarimizda H3K27me3 bilan belgilangan genlar sonini ko'rsatadigan Venn diagrammasi. Biz ilgari belgilangan genlarning 93,3 foizini, shuningdek, 3549 ta yangi genni tikladik. Mikkelsen tomonidan aniqlangan genlarning aksariyati va boshqalar. (2007) bizning ma'lumotlarimizda MACS (90%) yordamida aniqlangan, juda kichikroq ulush esa Puasson testi (58%) yordamida aniqlangan. Bu farq Mikkelsen tomonidan aniqlangan genlarda H3K27me3 ning qisqaroq domenlariga nisbatan moyillikni ko'rsatishi mumkin. va boshqalar. (2007).

ES hujayralaridan H3K27me3 ChIP-seq ma'lumotlar to'plamlarini taqqoslash. ( A ) H3K27me3 ma'lumotlaridagi xaritalangan o'qishlar soni bizning ma'lumotlarimiz (WEHI) va ommaviy ma'lumotlar (Mikkelsen) uchun ES hujayralaridagi butun genom bo'ylab 5 kb oraliqda baholandi. Har bir oraliqdagi o'qishlar soni umumiy xaritalangan o'qishlar nisbati sifatida ifodalangan. Ma'lumotlar jurnalga chizilgan 2 miqyosda va kuchli ijobiy korrelyatsiyani ko'rsatadi (Pirson korrelyatsiya koeffitsienti 0,92). ( B ) Turli qo'ng'iroq usullari (MACS yoki Poisson) yordamida bizning ma'lumotlarimizda H3K27me3 bilan belgilangan genlar sonini ko'rsatadigan Venn diagrammasi. Biz ilgari belgilangan genlarning 93,3 foizini, shuningdek, 3549 ta yangi genni tikladik. Mikkelsen tomonidan aniqlangan genlarning aksariyati va boshqalar. (2007) bizning ma'lumotlarimizda MACS (90%) yordamida aniqlangan, juda kichikroq ulush esa Puasson testi (58%) yordamida aniqlangan. Bu farq Mikkelsen tomonidan aniqlangan genlarda H3K27me3 ning qisqaroq domenlariga nisbatan moyillikni ko'rsatishi mumkin. va boshqalar. (2007).

H3K27me3 uchun sezilarli darajada boyitilgan genlarni aniqlash uchun biz MACS (34) dan foydalandik. MACS algoritmi odatda kuchli signal intensivligi bilan qisqa cho'qqilarni hosil qiluvchi transkripsiya faktorini bog'lash hodisalarini aniqlash uchun mo'ljallangan. Muayyan bog'lash profillariga nisbatan noto'g'ri munosabatni oldini olish uchun biz butun gen mintaqasi bo'ylab keng boyitishni izlash uchun qo'shimcha test ishlab chiqdik. Xususan, har bir gen hududidan keladigan o'qishlar soni Poisson testi yordamida kirish nazorati bilan taqqoslandi ("Materiallar va usullar" bo'limiga qarang). Ushbu usullar ES hujayralarida H3K27me3 bilan belgilangan genlarni aniqlash uchun qo'llanilganda, 2298 gen faqat MACS yordamida aniqlandi, 660 gen faqat Puasson testi yordamida aniqlandi va 2613 gen (46,9%) ikkala usul bilan aniqlandi (1-jadval va 1-rasm. B). Kutilganidek, biz MACS tomonidan belgilangan genlar H3K27me3 domenining Poisson testi bilan belgilangan genlarga qaraganda ancha qisqaroq ekanligini aniqladik (Qo'shimcha rasm S3). Xuddi shu usullar ushbu tadqiqotda foydalanilgan barcha boshqa ChIP-seq tajribalarida boyitilgan genlarni topish uchun qo'llanilgan.

Bizning tahlilimiz Mikkelsen tomonidan ilgari PRC2 maqsadlari sifatida aniqlangan genlarning katta qismini tikladi. va boshqalar. (5) ES hujayralarida (93,3%) va qo'shimcha 3549 H3K27me3 belgilangan genlarni aniqladi (1-rasm B). Xuddi shu yondashuvdan foydalanib, biz G1ME hujayralarida H3K27me3 uchun boyitilgan 6567 genni aniqladik (1-jadval). MACS yoki Puasson usuli bilan aniqlangan genlarning ulushi hujayra turiga qarab keng o'zgarib turardi, bu keng bog'lovchi domenlarning tarqalishidagi farqlarni ko'rsatadi.

Gen bo'ylab boyitish profillarini vizualizatsiya qilish

Har bir qiziqish belgisining taqsimlanishini baholash uchun biz birinchi navbatda barcha belgilangan genlar bo'yicha TSS atrofidagi o'rtacha qamrovni hisoblab chiqdik. Bundan tashqari, biz ASE syujetidan foydalanib, butun gen uzunligi bo'ylab boyitish naqshini batafsilroq ko'rib chiqdik. ASE syujeti har bir genni umumiy uzunlikka o'lchash va keyin signalni mos ravishda o'rtachalashtirish orqali genlar to'plami uchun boyitish profilini taqdim etadi. Ushbu chizma funktsiyalari mavjud Repitoollar paketini R ( 38 ) ga joylashtiring (batafsilroq tavsif va R kodi uchun qoʻshimcha maʼlumotlar uchun “Materiallar va usullar” boʻlimiga qarang).

RNApol-II ning TSS markazlashtirilgan uchastkasi bilan taqsimlanishini baholaganimizda, biz TSSda 2 kb oralig'ida cho'zilgan boyitishning keskin cho'qqisini kuzatdik. Bundan tashqari, signal yuqori oqim mintaqasiga qaraganda TSSning quyi oqimida, gen tanasida kuchliroq edi (2-rasm, A). Har bir genning tuzilishini hisobga olgan holda, ASE syujeti RNApol-II bandligi haqida qo'shimcha ma'lumotlarni ochib berdi. ASE syujetida RNApol-II boyitish TSSda va gen tanasi bo'ylab ko'rinadi, genning oxirida ikkinchi cho'qqi bor, bu tugatish paytida polimeraza to'xtab qolganligini ko'rsatishi mumkin (2-rasm). Ekspressiya darajasiga asoslangan genlarni qatlamlash RNApol-II bilan to'ldirilishi ifoda darajasiga mutanosib ravishda ortib borishini aniq ko'rsatdi (2-rasm C). RNApol-II ning bog'lanish profili ham hujayra turlari bo'yicha juda mos keladi (qo'shimcha rasm S4B, F, N va R).

TSS markazlashtirilgan, H3K27me3 va RNApol-II ning ASE va ifoda qatlamli ASE uchastkalari. TSS markazlashtirilgan o'rtacha uchastkalarini taqqoslash ( A , D va G ) ASE uchastkalari bilan ( B , E. va H ) ES hujayralarida RNApol-II va ES hujayralari va G1MElarda H3K27me3 bilan belgilangan genlar uchun. Masshtabli versiyada TSS markazlashtirilgan ko'rinishida kuzatilmaydigan ma'lumotlar mavjud. ( C , F va Men ) Ekspressiya bilan tabaqalashtirilgan barcha genlarning ASE chizmalari. O'rtacha daraja pastroq, chunki ular nafaqat belgilangan genlar, balki ifoda massividagi barcha genlar uchun ChIP-seq ma'lumotlarini o'z ichiga oladi.

TSS markazlashtirilgan, H3K27me3 va RNApol-II ning ASE va ifoda qatlamli ASE uchastkalari. TSS markazlashtirilgan o'rtacha uchastkalarini taqqoslash ( A , D va G ) ASE uchastkalari bilan ( B , E. va H ) ES hujayralarida RNApol-II va ES hujayralari va G1MElarda H3K27me3 bilan belgilangan genlar uchun. Masshtabli versiyada TSS markazlashtirilgan ko'rinishida kuzatilmaydigan ma'lumotlar mavjud. ( C , F va Men ) Ekspressiya bilan tabaqalashtirilgan barcha genlarning ASE chizmalari. O'rtacha daraja pastroq, chunki ular nafaqat belgilangan genlar, balki ifoda massividagi barcha genlar uchun ChIP-seq ma'lumotlarini o'z ichiga oladi.

H3K27me3 ning tarqalishi ES hujayralari va G1ME hujayralarida tekshirildi. ES hujayralarida TSS atrofida H3K27me3 ning kuchli boyitilishi kuzatildi (2-rasm D), G1ME hujayralarida signal ancha past edi (2-rasm). TSS markazlashtirilgan uchastkalarining umumiy xususiyati TSS atrofida H3K27me3 ning keskin tushishi bo'lib, nukleosomalar kamaygan zonaning holatiga mos keladi (40). H3K27me3 signalining ASE chizmalarida ma'lumotlarga qo'llaniladigan tekislash tufayli nukleosoma yo'qolgan zona aniq emas edi. ASE chizmalari H3K27me3 genlarning butun uzunligi bo'ylab taqsimlanganligini ko'rsatadi, ammo biz hujayra turlari o'rtasidagi boyitish profilidagi keskin farqlarni sezdik. ES hujayralarida boyitishning eng kuchli cho'qqisi TSSda sodir bo'lgan (2-rasm E), G1ME hujayralarida esa tepalik TSS dan yuqoriga siljigan (2-rasm H). Genlarni ekspressiya darajasiga qarab tabaqalash H3K27me3 repressiya qilingan genlarda yuqori darajada boyitilganligini tasdiqladi, ammo H3K27me3 profilining shakli ham ifoda darajasiga qarab o'zgarib, H3K27me3 ning gen bo'ylab tarqalishi transkripsiyani tartibga solish uchun muhim bo'lishi mumkinligini ko'rsatadi (2-rasm F va I).

H3K27me3 bilan belgilangan genlar alohida boyitish profillariga ega

ES hujayralari va G1MEs o'rtasidagi H3K27me3 boyitish profilidagi farqlarga qaramay, har bir hujayra turida belgilangan genlar katta darajada bir-biriga mos kelishini ko'rsatadi (3-rasm, A). Shu bilan birga, boyitish profillarining hujayra tipining o'ziga xosligi umumiy belgilangan genlar uchun ham saqlanib qoldi (3-rasm B va C), bu PRC2 belgilarining namunasi aniq hujayra va rivojlanish kontekstiga qarab farq qilishini ko'rsatadi. Bundan tashqari, har bir hujayra turi uchun H3K27me3 tomonidan belgilangan genlar uchun profillar ikkita hujayra turi o'rtasidagi ajoyib farqlarni ko'rsatdi (3-rasm D va E). Eng ko'zga ko'ringan farq TSSda kuchliroq signalga ega bo'lgan ES hujayralari bilan solishtirganda G1ME-ga xos genlarning promotor mintaqasida aniq cho'qqi edi.

ES va G1ME hujayralarida eksklyuziv va odatda H3K27me3 bilan belgilangan genlar profillari. ( A ) Venn diagrammasi ES hujayralari va G1ME lardagi belgilangan genlar o'rtasidagi o'xshashlikni ko'rsatadi. ( B va C ) ES va G1ME da H3K27me3 uchun boyitilgan 2689 gen uchun H3K27me3 signalining ASE chizmalari. Har bir uchastkada qizil chiziqlar genning chegaralarini bildiradi va kirish boshqaruvidagi signal darajasi chiziladi (kulrang chiziq). ( D va E. ) Hujayra turiga xos genlar uchun H3K27me3 signalining ASE uchastkalari (har bir hujayra chizig'i uchun genlar soni farq qiladi: ES hujayralari = 3180, G1MEs = 3887).

ES va G1ME hujayralarida eksklyuziv va odatda H3K27me3 bilan belgilangan genlar profillari. ( A ) Venn diagrammasi ES hujayralari va G1ME lardagi belgilangan genlar o'rtasidagi o'zaro bog'liqlikni ko'rsatadi. ( B va C ) ES va G1ME da H3K27me3 uchun boyitilgan 2689 gen uchun H3K27me3 signalining ASE chizmalari. Har bir uchastkada qizil chiziqlar genning chegaralarini bildiradi va kirish boshqaruvidagi signal darajasi chiziladi (kulrang chiziq). ( D va E. ) Hujayra turiga xos genlar uchun H3K27me3 signalining ASE uchastkalari (har bir hujayra chizig'i uchun genlar soni farq qiladi: ES hujayralari = 3180, G1MEs = 3887).

Biz faraz qildikki, bu aniq boyitish profillari har bir hujayra turidagi o'xshash boyitish naqshiga ega bo'lgan ko'plab genlarning natijasidir. Ushbu bashoratni sinab ko'rish uchun biz ASE uchastkalarida ko'rilgan boyitishning uchta umumiy modelini aniqladik, biz muhim va aniq deb hisoblaymiz. Birinchidan, TSS atrofida H3K27me3 ko'p bo'lgan genlar mavjud bo'lib, ular asosan ES hujayralarida aniq ko'rinadi (3-rasm B va D). Ikkinchidan, genning butun uzunligi bo'ylab keng boyitishni ko'rsatadigan genlar mavjud edi. Uchinchidan, H3K27me3 uchun TSSning yuqori oqimida kuchli boyitilgan, G1ME hujayralarida eng aniq bo'lgan genlar sinfi paydo bo'ldi (2 H va 3 E rasmlari).

Biz keng, TSS va promotor deb ataydigan uchta sinfdan biriga kiruvchi H3K27me3 naqshlariga ega bo'lgan individual genlarni aniqlash uchun bir qator konservativ mezonlarni ishlab chiqdik ("Materiallar va usullar" bo'limiga qarang). Ushbu mezonlar bizning ES hujayramiz va G1ME ma'lumotlarimizdagi H3K27me3 uchun boyitilgan barcha genlarni tasniflash uchun ishlatilgan. Biz genlarning katta qismi biz aniqlagan uchta sinfdan biriga ishonchli va aniq belgilanishi mumkinligini aniqladik. Biz ES hujayralaridan boyitilgan genlarning 21 foizini va G1ME hujayralaridan 30 foizini uchta profil guruhimizga ajratdik (belgilangan genlarning to'liq ro'yxati va profil tasnifi uchun S3 qo'shimcha jadvaliga qarang). Ikkala hujayra turida ham boyitishning uchta sinfi uchun dalillarni topamiz, ammo har bir sinfdagi genlarning nisbati juda farq qiladi (4-rasm A va E). 4-rasmda uchta sinfning har biriga ajratilgan ES hujayralari va G1ME uchun ASE sxemasi ko'rsatilgan. Barcha belgilangan genlarning ASE uchastkalarini ko'rib chiqishdan kutganimizdek (3-rasm), ES hujayralari TSS genlarining yuqori qismini o'z ichiga oladi, G1ME hujayralari esa keng genlar va promotor genlarning yuqori qismini o'z ichiga oladi.

Profillarning tasnifi. Har bir H3K27me3 boyitish profili uchun ASE chizmalari ES hujayralari uchun ko'rsatilgan ( B ) va G1ME hujayralari ( F ). Har bir boyitish profiliga tasniflangan genlar soni qo'shni chiziqli chizmalarda ko'rsatilgan ( A va E. ). ESdagi har bir gen sinfi uchun RNApol-II ning ASE chizmalari ( C ) va G1ME hujayralari ( G ). Promoter genlar RNApol-II uchun kuchli boyitishni ko'rsatadi, TSS va keng genlar esa yo'q. ES hujayralaridagi genlarning har bir klassi uchun ifoda darajalarining qutilari ko'rsatilgan ( D ) va G1ME hujayralari ( H ). Promotor profili bilan tasniflangan genlar yuqori ifoda darajasini ko'rsatadi, keng profilli genlar esa eng past ifoda darajalariga ega. TSS sifatida tasniflangan genlar oraliq ifoda darajalariga ega, ammo baribir massivdagi barcha genlarning o'rtacha qiymatiga nisbatan repressiya qilinadi.

Profillarning tasnifi. Har bir H3K27me3 boyitish profili uchun ASE chizmalari ES hujayralari uchun ko'rsatilgan ( B ) va G1ME hujayralari ( F ). Har bir boyitish profiliga tasniflangan genlar soni qo'shni chiziqli chizmalarda ko'rsatilgan ( A va E. ). ESdagi har bir gen sinfi uchun RNApol-II ning ASE chizmalari ( C ) va G1ME hujayralari ( G ). Promoter genlar RNApol-II uchun kuchli boyitishni ko'rsatadi, TSS va keng genlar esa yo'q. ES hujayralaridagi genlarning har bir klassi uchun ifoda darajalarining qutilari ko'rsatilgan ( D ) va G1ME hujayralari ( H ). Promotor profili bilan tasniflangan genlar yuqori ifoda darajasini ko'rsatadi, keng profilli genlar esa eng past ifoda darajalariga ega. TSS sifatida tasniflangan genlar oraliq ifoda darajalariga ega, ammo baribir massivdagi barcha genlarning o'rtacha qiymatiga nisbatan repressiya qilinadi.

K -G1ME hujayralarida genik H3K27me3 profillarining klasterlanishini bildiradi. Signalning intensivligi spektrogramma sifatida ko'rsatilgan, qizil rang yuqori boyitish signalini aks ettiradi va ko'k rang hech qanday signalni aks ettirmaydi. Barcha genlar bir xil uzunlikka ega bo'lish uchun masshtablangan va TSSga nisbatan pozitsiyasi foizlarda ko'rsatilgan. Genlar avval klaster bo'yicha, keyin tasniflash bo'yicha saralangan (qora: keng yashil: promotor ko'k: TSS kulrang: belgilangan, ammo tasniflanmagan). Barcha genlarning ifoda darajasi eng o'ng tomonda ko'rsatilgan. Boshqa hujayra turlari uchun qo'shimcha klaster profillari taqdim etiladi (qo'shimcha S8-rasm).

K -G1ME hujayralarida genik H3K27me3 profillarining klasterlanishini bildiradi. Signalning intensivligi spektrogramma sifatida ko'rsatilgan, qizil rang yuqori boyitish signalini aks ettiradi va ko'k rang hech qanday signalni aks ettirmaydi. Barcha genlar bir xil uzunlikka ega bo'lish uchun masshtablangan va TSSga nisbatan pozitsiyasi foizlarda ko'rsatilgan. Genlar avval klaster bo'yicha, keyin tasniflash bo'yicha saralangan (qora: keng yashil: promotor ko'k: TSS kulrang: belgilangan, ammo tasniflanmagan). Barcha genlarning ifoda darajasi eng o'ng tomonda ko'rsatilgan. Boshqa hujayra turlari uchun qo'shimcha klaster profillari taqdim etiladi (qo'shimcha S8-rasm).

4-rasmda genlarni keng, TSS va promotor sifatida tasniflash uchun foydalanilgan kutilgan boyitish xususiyatlarini ko'rsatishdan tashqari, har bir sinfga xos bo'lgan va hujayra turlari bo'ylab doimiy bo'lgan qo'shimcha xususiyatlar ham aniqlangan. Xususan, TSS genlari TSS atrofida boyitishning kutilgan cho'qqisini gen tanasi bo'ylab kam yoki umuman boyitmasdan ko'rsatadi. Bundan farqli o'laroq, keng genlar gen tanasida kuchli boyitilganligini ko'rsatadi, ular asta-sekin transkripsiyaning boshlanishi va oxiridan tashqari fonga torayib boradi. Bu shuni ko'rsatadiki, bu genlarning ba'zilari uchun H3K27me3 domeni intergenik mintaqaga yaxshi tarqaladi, bu H3K27me3 genomini katta bloklarda belgilashi mumkinligi haqidagi kuzatuvga mos keladi (27). Nihoyat, promotor genlar H3K27me3 ning TSS dan yuqori oqimida kuchli boyitilganligini ko'rsatadi, lekin gen tanasi bo'ylab fon darajasidan pastroqda H3K27me3 ning kamayishini ko'rsatadi. H3K27me3 belgisining kamayishi yuqori darajada ifodalangan genlarda ham kuzatiladi (2-rasm F va I), bu genlar faol ravishda transkripsiya qilinishi mumkinligini ko'rsatdi.

H3K27me3 boyitish profillarini tekshirish

H3K27me3 belgilangan genlar tasnifini uchta alohida profilga (TSS, promotor va keng) tasdiqlash uchun biz har bir toifadagi bir qancha genlarni tanladik va ChIP-qPCR yordamida ularning boyitish profilini tasdiqladik. Xususan, biz promouterda H3K27me3 uchun yuqori boyitish darajasini ko'rsatdik DNMT3A , FNIP1 va RTN4 G1ME hujayralarida va TSSda H3K27me3 ning past yoki yo'qligi va bu genlar uchun gen tanasida. Bundan tashqari, biz ikkita genni tanladik, SCUBE2 va PDE8A , ES hujayralarida H3K27me3 boyitishning TSS profili va G1ME hujayralarida keng profilga ega bo'lgan va ikkita qPCR amplikon yordamida bu farqni tasdiqlagan. Barcha tajribalar uch nusxada o'tkazildi va biz ChIP-Seq va ChIP-qPCR o'rtasida yaxshi muvofiqlikni kuzatdik. Bu ChIP-Seq ma'lumotlarida kuzatilgan H3K27me3 tarqalishini tasdiqladi va H3K27me3 boyitish profili uyali kontekstga qarab farq qilishini tasdiqladi (Qo'shimcha rasm S5).

Tasniflashlarimizning kengroq qo'llanilishini sinab ko'rish uchun biz tahlilimizni ES, MEF va NP hujayralari uchun ochiq H3K27me3 ChIP-Seq ma'lumotlarini (5) va har bir holatda aniqlangan promotor, TSS va keng genlarni o'z ichiga oldik (Qo'shimcha rasm S6). Belgilangan genlarning muhim qismini promotor, TSS yoki uchta hujayra turida keng (20% ES, 26% MEF, 21% NP) deb tasnifladik. Har bir hujayra turidagi har bir sinfdagi genlarni aniqlash imkoniyatiga ega bo'lishiga qaramay, aniqlangan belgilangan genlarning umumiy soni bizning yangi yaratilgan ma'lumotlarimizda ommaviy ma'lumotlar to'plamlari bilan solishtirganda ko'proq edi. Bu, ehtimol, texnologiyaga asoslangan ma'lumotlar sifatini yaxshilash natijasidir, yuqori aniqlik belgilangan genlarni aniqlash va boyitish profillarini tasniflash uchun ko'proq kuch beradi.

Promotorlardagi H3K27me3 faol transkripsiya bilan bog'liq

Turli profil sinflarining (promoter, TSS va keng) funktsional xususiyatlarini sinab ko'rish uchun biz har bir sinfning mRNK ifoda darajasini baholadik. Genlarning har xil sinflari uchun biz ularning tegishli ifoda qiymatlarining quti chizmalarini hisoblab chiqdik (4-rasm D va H). ES va G1ME hujayralarida izchil tendentsiya kuzatildi. Birinchidan, keng miqyosda belgilangan genlar aniqlangan genlarning eng past ifodalangan to'plami edi. Ikkala hujayra turida ham keng genlar o'rtacha belgilangan genga qaraganda kamroq ifodalangan ( P < 5.1 × 10 -12, <2.2 × 10-16, Mann-Whitney testi ES hujayralari va G1ME hujayralari uchun mos ravishda). Ikkinchidan, genlarning TSS sinfi belgilangan genlarning o'rtacha qiymatiga mos keladigan ifoda darajalariga ega edi va massivdagi o'rtacha genga nisbatan repressiya qilindi ( P < 2,2 × 10 -16 , 1,1 × 10 -7). Keng va TSS genlaridan farqli o'laroq, promotor genlar o'rtacha belgilangan genga nisbatan yuqori darajada ifodalangan. Darhaqiqat, G1ME uchun promotor genlarining ifoda darajasi massivdagi barcha belgilanmagan genlarning o'rtacha qiymatidan sezilarli darajada yuqori edi ( P < 1,39 × 10 −9 ). Promouterlarida H3K27me3 bo'lishiga qaramay, bu genlar repressiya qilinmaydi, aksincha ular yuqori darajada ifodalangan ko'rinadi.

Turli sinflar uchun RNApol-II boyitish darajasi ifoda ma'lumotlari natijalariga mos keldi (4-rasm C va G). Ya'ni, promotor genlari RNApol-II bilan bog'lanishning yuqori darajasiga ega, keng genlar va TSS klassi esa RNApol-II mavjudligini ko'rsatadi. Nihoyat, barcha belgilangan genlarni olib, 5% eng yuqori ifodalangan genlarni va 5% eng kam ifodalangan genlarni chizib, biz tasniflash mezonlaridan foydalanmasdan keng va promouter profillarini tiklay oldik (Qo'shimcha rasm S7).

H3K27me3 ning ifodaning yuqori darajasiga hissa qo'shayotganini aniqlash uchun biz Suz12 nokautli ES hujayralarida (41) va PRC2 ni buzgan Suz12 nokautli G1ME hujayralarida promotor genlarining ifoda darajasini o'rganib chiqdik. Umuman olganda, biz H3K27me3 modifikatsiyalangan genlarda kamtarona ifoda o'zgarishlarini kuzatdik va ikkita hujayra turi o'rtasida promotor genlarida izchil o'zgarishlarni topmadik (Qo'shimcha rasm S10). Ikkita asosiy ogohlantirish bizning ushbu ma'lumotlarni sharhlashimizga ta'sir qiladi: birinchidan, ifoda ma'lumotlari va ChIP-Seq ma'lumotlari bir xil hujayralardan olinmagan (Suz12 nokautli ES hujayra ma'lumotlari nashr etilgan mikroarraylardan olingan) va ikkinchidan, biz H3K27me3 darajasini baholamadik. PRC2 ni inhibe qilgandan keyin promouterlarda. Shuning uchun promotordagi H3K27me3 transkripsiyada faollashtiruvchi rolga ega yoki muqobil funktsiyani bajarishini aniqlash uchun qo'shimcha tajribalar talab qilinadi.

K -klasterlash tasniflashni tasdiqlaydi

Klasterlash yondashuvlari T hujayralarida H3K4me2 belgisi uchun alohida boyitish profillarini ajratish uchun ishlatilgan (10). H3K27me3 profillarimiz tasniflarini batafsil o'rganish uchun biz bajardik k -5 kb dan uzun barcha genlar uchun klasterlash demakdir. 5-rasmda G1ME hujayralarida beshta guruhdan foydalangan holda genlarni klasterlash natijalari ko'rsatilgan. Eng katta klaster H3K27me3 ning hech qanday boyitilmagan genlarga mos keladi. Boshqa klasterlar bizning belgilangan sinflarimiz bilan aniq bog'lanishi mumkin. Xususan, promotor genlarning bitta klasteri, yuqori o'rtacha boyitilgan keng miqyosda belgilangan genlar klasteri va past o'rtacha boyitilgan keng belgili genlar klasteri mavjud. Ushbu natijalar bizning tasniflash sxemamizni qo'llab-quvvatlaydi va mezonlarimiz konservativligini ko'rsatadi. Bizning tasniflash sxemamiz faqat qo'llaniladigan har bir sinfdagi eng ishonchli misollarni aniqlaydi k - har bir klasterga ko'proq genlar tayinlangan klasterlash degan ma'noni anglatadi. Bizning tasniflash yondashuvimiz G1ME-larda alohida klasterni tashkil etmaydigan TSS profili kabi boyitish profillarining kichikroq populyatsiyalarini ishonchli aniqlashga muvaffaq bo'ldi. Xuddi shunday, ES hujayralariga klasterlashni qo'llashda TSS klassi ishonchli tarzda aniqlangan, ammo promotor klassi aniqlanmagan. Shunday qilib, klasterlash eng keng tarqalgan sinflarni aniqlashda yaxshi bo'lsa-da, u kamroq tarqalgan profillarni ishonchli tarzda aniqlay olmaydi (Qo'shimcha rasm S8A-D). R kodi yordamida klaster chizmalarini yaratish uchun taqdim etiladi Repitoollar paket (38) (Qo'shimcha ma'lumotlarga qarang).

ES hujayralarida H3K4me3, H3K36me3 va H3K27me3 boyitish o'rtasidagi munosabatlar. H3K36me3 gen bo'ylab boyitish ( A ) va TSS atrofida H3K4me3 boyitish ( B ) Promotor, TSS va ES hujayralaridagi genlarning keng sinflari uchun. ES hujayralarida H3K27me3 signalining ASE syujetlari, bu erda genlar H3K27me3 va H3K4me3 (H3K27me3 va H3K4me3) bilan belgilangan chaqirilish asosida ajratilgan. C ). Qattiq chiziq ikki valentli genlar uchun profildir (H3K27me3 va H3K4me3 bilan belgilanadi). Chiziqli chiziq faqat H3K27me3 bilan belgilangan genlarga mos keladi va nuqta chiziq faqat H3K4me3 bilan belgilangan genlar uchun H3K27me3 profilidir.

ES hujayralarida H3K4me3, H3K36me3 va H3K27me3 boyitish o'rtasidagi munosabatlar. H3K36me3 gen bo'ylab boyitish ( A ) va TSS atrofida H3K4me3 boyitish ( B ) promotor, TSS va ES hujayralaridagi genlarning keng sinflari uchun. ES hujayralarida H3K27me3 signalining ASE syujetlari, bu erda genlar H3K27me3 va H3K4me3 (H3K27me3 va H3K4me3) bilan belgilangan chaqirilish asosida ajratilgan. C ). Qattiq chiziq ikki valentli genlar uchun profildir (H3K27me3 va H3K4me3 bilan belgilanadi). Chiziqli chiziq faqat H3K27me3 bilan belgilangan genlarga mos keladi va nuqta chiziq faqat H3K4me3 bilan belgilangan genlar uchun H3K27me3 profilidir.

Promotor profili hujayra turlari orasida saqlanadi

Biz boshqa hujayra turlarida (ES, MEF, NP qo'shimcha rasm S9A-C) G1MElarda promotor, TSS va keng deb belgilangan genlarning profillarini chizdik. G1MElarda keng yoki TSS deb tasniflangan genlar odatda boshqa hujayra turlarida TSS profilini ko'rsatishini aniqladik. Aksincha, promotorlar sinfida aniqlangan genlar boshqa hujayra turlarida bir xil promouter profilini ko'rsatdi. Ushbu promotor genlar, shuningdek, barcha hujayra turlarida yuqori darajada ifodalangan bo'lib, ular hujayra turlari o'rtasida barqaror boyitish profillari va ifoda naqshiga ega ekanligini ko'rsatadi (Qo'shimcha rasm S9D-F).

Promotor genlari bilan bog'liq bo'lgan qo'shimcha omillarni o'rganish uchun biz birinchi navbatda UCSC trekidan foydalangan holda TSS dan 3 kb yuqoridagi har qanday CpG orollari bilan genlarni aniqladik ( http://genome.ucsc.edu/cgi-bin/hgTables ). Taxminan 80% promotor genlarida CpG orollari TSS dan 3 kb yuqorida joylashgan, genom bo'yicha o'rtacha 37%. Promotorida CpG orollari bo'lgan genlar ilgari uy xo'jaligi genlari (5) bilan bog'liq bo'lib, promotor genlari hamma joyda ifodalanganligini kuchaytirdi.

Promouterdagi H3K27me3 signali to'g'ridan-to'g'ri tartibga solish mexanizmi emas, balki qo'shni gendan metilatsiya tarqalishini aks ettirgan. Bu promotor genlarning bir qismiga tegishli bo'lishi mumkin, chunki biz promotor genlaridan to'g'ridan-to'g'ri yuqorida joylashgan genlar promotor genlarining quyi oqimidagi genlarga yoki keng sinfning yonbosh genlariga nisbatan yuqori H3K27me3 darajasiga ega ekanligini aniqladik (Qo'shimcha). S11-rasm). Shunga qaramay, promotor genlarining atigi 35 foizi belgilangan deb tasniflangan genning quyi oqimida bo'lgan, bu esa promotor profili ham mustaqil ravishda sodir bo'lishini ko'rsatadi.

Promotorlar sinfida ifodalangan genlar toifalari haqida tushunchaga ega bo'lish uchun biz Gen ontologiyasi va KEGG yo'llari tahlilini o'tkazdik (42, 43) (4-qo'shimcha jadvalda, KEGG yo'llari qo'shimcha S5-jadvalda ko'rsatilgan klasterli natijalar). Ushbu tahlil shuni ko'rsatdiki, promotor genlar hujayra signalizatsiyasida ishtirok etadigan genlar, shu jumladan Ras yo'lida ishtirok etadigan ko'plab genlar uchun boyitilgan. Biroq, klassik Polycomb maqsadli genlari, shu jumladan Hox genlari va rivojlanish, naqsh spetsifikatsiyasi va organlar rivojlanishi bilan bog'liq genlar keng sinfda taqdim etilgan (Qo'shimcha jadval S3).

Bivalent genlar TSS sinf genlaridir

H3K27me3 belgilangan genlarning uchta sinfini yanada tavsiflash uchun biz H3K27me3 profili va boshqa histon modifikatsiyalari o'rtasidagi munosabatni o'rganib chiqdik. H3K4me3 va H3K36me3 ham transkripsiya cho'zilishi bilan bog'liq bo'lgan belgi ES hujayralarida, NP hujayralarida va MEFlarda o'rganilgan (5). Ushbu ma'lumotlar H3K27me3 va RNApol-II ma'lumotlari bilan bir xil tarzda qayta ishlandi va belgilangan genlar aniqlandi (1-jadval). ES hujayralarida, NP hujayralarida va MEFlarda H3K4me3 bilan belgilangan genlarning ASE chizmalari (Qo'shimcha rasm S4O, T va W) H3K4me3 signalining katta qismi TSS atrofidagi mintaqada lokalizatsiya qilinganligini ko'rsatadi, bu ilgari e'lon qilingan topilmalarni tasdiqlaydi (44). Aksincha, ASE syujetlari H3K36me3 deyarli har doim butun genda mavjudligini ko'rsatadi, bu ham oldingi tadqiqotlarga mos keladi (9) (Qo'shimcha rasm S4P, U va X). Shuning uchun biz H3K4me3 va H3K36me3 uchun ASE uchastkalarini tekshirish uchun TSS markazlashtirilgan uchastkasidan foydalandik. Nihoyat, biz H3K36me3 va H3K4me3 mRNK ifodasi bo'yicha ikkala belgini tabaqalash orqali yuqori darajada ifodalangan genlarda ko'proq tarqalganligini tasdiqladik (Qo'shimcha rasmlar S12 va S13).

Promotor genlari (H3K27me3 belgisi bilan belgilangan) H3K36me3 va H3K4me3 uchun boyitilganligini aniqladik, bu genlar faol ravishda transkripsiya qilinadi. Bundan farqli o'laroq, genlarning keng klassi ushbu modifikatsiyalarning har biri uchun kam boyitilganligini ko'rsatdi (6-rasm A va B). TSS genlar sinfi H3K4me3 uchun kuchli boyitilgan, ammo H3K36me3 signali yoki RNApol-II bog'lanishini kam ko'rsatdi. Ushbu kuzatishlar TSS klassi tartibga soluvchi signallarga javob berishga tayyor bo'lgan ko'plab bivalent genlarni o'z ichiga oladi degan fikrni qo'llab-quvvatlaydi.

Keyinchalik, ikki marta belgilangan (H3K27me3 va H3K4me3 belgilariga ega bo'lganlar) va faqat H3K27me3 yoki H3K4me3 bilan belgilangan genlar uchun ASE ni hisoblab chiqdik (6-rasm). Ikki marta belgilangan genlar uchun H3K27me3 profili TSS genlar sinfining profiliga juda o'xshaydi, faqat H3K27me3 bilan belgilangan genlar keng boyitish profilini ko'rsatadi. Bu ikki valentli genlar asosan H3K27me3 (22) ning kichik domeniga ega ekanligiga yana bir dalil beradi. Kutilganidek, faqat H3K4me3 deb tasniflangan genlar H3K27me3 ning ahamiyatsiz darajasini ko'rsatdi.

ES hujayralarida H3K27me3 tomonidan belgilangan 5538 ta gendan 4737 tasi (86%) H3K4me3 tomonidan belgilanishini ko'rsatdi. TSS va promotor genlari ikki baravar belgilangan genlar orasida ko'proq ifodalangan, TSS genlarining 94 foizi ikki marta belgilangan ( P = 3 × 10 −7, ikki tomonlama Fisherning aniq testi) va promotor genlarning 96% ikki marta belgilangan ( P = 2 × 10 -9). TSS genlari ikki valentli genlar bo'lib, H3K27me3 belgisi va H3K4me3 belgilari bir-biriga mos keladi, promotor genlari esa bir-birining ustiga chiqadigan profillarga ega bo'lishi dargumon. Aksincha, keng genlar ushbu to'plamda kam ifodalangan, faqat 75% ikki marta belgilangan ( P = 8 × 10 -12 c.f. H3K27me3 bilan belgilangan barcha genlarning 86% ikki barobar belgilangan).


Usullari

Brakipodium o'sish sharoitlari va stressni davolash

bZIP10-GFP haddan tashqari ifodalanishini ishlab chiqarish va tavsiflash Brakipodium ilgari tasvirlangan [17]. Qisqacha aytganda, cDNK oksidlovchi stressli barg to'qimalaridan tayyorlangan Brachypodium distachyon va C-terminal GFP yorlig'i bilan ZmUbi1 promouteri nazorati ostida o'zgartirilgan pART vektoriga [22] kiritilgan bZIP10 genini (Bradi1g30140) kuchaytirish uchun shablon sifatida ishlatilgan. Qurilish aylantirildi Agrobakteriyalar o'zgartirish uchun ishlatilgan AGL1 [23] shtammi Brachypodium distachyon. Ushbu ZmUbi1::bZIP10-GFP konstruktsiyasi bilan o'zgartirilgan o'simliklar yovvoyi turdagi o'simlikka nisbatan odatdagidek rivojlangan [17].

Bd21-3 yoki bZIP10-GFP urug'lari o'zgartirildi Brachypodium distachyon [17] Osmocote Plus 15-9-12 (The Scotts Company, Marysville, OH) bilan SB40 Sunshine Growing Mix (Sun Gro Horticulture Inc., Bellevue, WA) ekilgan. Ekishdan so'ng, urug'lanishni sinxronlashtirish uchun idishlar 5 kun davomida 8 soat kunlik 4 ° C haroratda joylashtirildi. Keyin o'simliklar Conviron PGV36 o'sish kamerasiga (Conviron, Winnipeg, Kanada) 24 ° C da 20 soat yorug'lik va 18 ° C da 4 soat qorong'ilik uchun o'rnatildi. O'simliklar ChIP ketma-ketligi va ekspression tajribalari uchun barg to'qimalari yig'ib olinishidan oldin unib chiqqandan keyin kamida olti hafta davomida o'stirildi. Paraquat bilan davolash mavjud barg toksikligi protokollarining o'zgartirilgan versiyasidan foydalangan holda amalga oshirildi [17, 24, 25]. Paraquat barglarini davolash uchun 7-10 sm uzunlikdagi barglar yig'ib olindi, 160 mkM paraquatning yangi eritmalariga joylashtirildi, vakuum 5 daqiqa davomida uy vakuum bilan infiltratsiya qilindi va xona haroratida 24 soat davomida doimiy yorug'lik ostida yumshoq rokerga joylashtirildi. . ChIP uchun paraquat bilan ishlangan barg to'qimalari vakuum infiltratsiyasi ostida 20 daqiqa davomida fosfat tamponlangan sho'r suvda (PBS) 1% formaldegid bilan formaldegid o'zaro bog'lanishidan oldin steril distillangan suvda qisqa vaqt davomida yuvilgan. Namunalarga to'g'ridan-to'g'ri glitsin (125 mM yakuniy konsentratsiya) qo'shilishi va qo'shimcha 10 daqiqa davomida vakuum infiltratsiyasini qo'llash orqali o'zaro bog'lanish tugatildi. To'qimalar yuviladi, quritiladi va keyin suyuq azotda mayda kukunga aylantiriladi.

ChIP-ketmalash va ChIP-qPCR

ChIP-Seq xizmati Zymo Research Corporation (Zymo Research Corp., Irvine, CA) tomonidan amalga oshirildi. Xromatin Zymo-Spin™ ChIP to'plami (Zymo Research Corp., Irvine, CA) yordamida o'simlik kromatinini izolyatsiya qilish uchun o'zgartirilgan protokoli asosida tayyorlangan. Ultrasonikatsiya Bioruptor Plus™ (Diagenode Inc., Denville, NJ) yordamida 40 tsikl (30 s yoqilgan, 30 s o'chirilgan) uchun yuqori quvvat sozlamalarida amalga oshirilib, DNK fragmenti o'lchami 200–700 bp diapazonini berdi. ChIP tahlili uch nusxada amalga oshirildi (N. = 3) bZIP10-GFP oqsilini nishonga olish uchun 12 mkg xromatin va 10 mkg anti-GFP ChIP darajasidagi antikor (Abcam ab290, lot #GR240324–1 www.abcam.com) yordamida. Anti-IgG (Millipore, PP64B Lot 2,565,474) 10 mkg konsentratsiyada salbiy nazorat sifatida kiritilgan. ChIP DNK ChIP DNA Clean and Concentrator™ (Zymo Research Corp, Irvine, CA) yordamida tozalandi. ChIP-Seq kutubxonalari HiSeq 1500 sekvenserida (Illumina, San-Diego, CA) tayyorlandi va ketma-ketlashtirildi. ChIP-Seq o'qishlari moslashtirildi Braxipodium diastaxikon Bowtie [26] tomonidan ko'pi bilan 2 ta nomuvofiqlik bilan mos yozuvlar genomi (3.1 versiyasi). Xuddi shu ipda bir xil holatda ikki martadan ko'proq paydo bo'lgan o'qishlar PCR takrorlanishini olib tashlash uchun o'chirildi. BigWig fayllari vizualizatsiya maqsadida hizalanishdan yaratilgan [27]. MACS2 (Model-based Analysis of ChIP-Seq) [28] q-qiymati 0,05 chegarasi yordamida cho'qqilarni aniqlash uchun ishlatilgan.

Bundan tashqari, ChIP-qPCR tahlili Zymo Research Corporation tomonidan amalga oshirildi. Qisqacha aytganda, 10 ta noyob primer to'plamlari GFP ChIP ketma-ketligi ma'lumotlarida aniqlangan bir qator boyitilgan hududlarni kuchaytirish uchun mo'ljallangan. Ikki mustaqil ChIP tahlilidan boyitilgan anti-GFP ChIP va IgG salbiy nazorat DNKsi ZymoTaq™ qPCR Premix (Zymo Research Corp., Irvine, CA) yordamida kuchaytirildi. ChIP DNKning boyitilganligi kiritilgan% sifatida aniqlandi (ya'ni, qPCR tahlilidan so'ng 100% kirish DNK bilan solishtirganda immunoprecipitatsiya qilingan DNKning nisbiy miqdori).

Motif tahlili

bZIP10 transkripsiya faktorining mumkin bo'lgan bog'lash motivlarini aniqlash uchun ChIP tepalik ketma-ketliklari MEME (Multiple EM for Motif Elicitation) -ChIP [29] ga o'tkazildi. MEME-ChIP dasturi ikkita ab initio motivni aniqlash algoritmidan foydalanadi: MEME [30] va DREME (Discriminative Regular Expression Motif Elicitation) [31], bu MEME tomonidan oʻtkazib yuborilgan qisqa eukaryotik TF motivlarini qidirish uchun muntazam iboralardan foydalanadi.

BdbZIP10 TF maqsadli genlarining gen funktsiyasi

BdbZIP10 maqsadli genlarining taxminiy funktsiyalarini aniqlash uchun ChIP-Seq cho'qqilariga ega bo'lgan 259 ta genlar to'plami yuqoridagi promouter mintaqalarida yoki potentsial quyi oqim tartibga soluvchi hududlarda (transkripsiya boshlang'ich joyidan 2 kb yuqorida yoki to'xtash kodonining quyi oqimida 2 kb) yoki izohlangan ichida joylashgan. gen tanalari AgriGO onlayn Gen to'plamini boyitish tahlili (GSEA) vositasidan foydalangan holda Gen Ontologiyasi (GO) toifalari asosida tahlil qilindi [32, 33]. Ishlab chiqarish uchun standart Fisherning aniq testi va Benjamini-Yekutieli ko'p test tuzatish usullari [34] ishlatilgan. p-statistik ahamiyatga ega bo'lgan qiymatlar va mos keladigan False Discovery Rate (FDR) qiymatlari.

Oksidlanish stressi (paraquat bilan davolash) mavjudligi yoki yo'qligida ularning ifoda darajasini aniqlash uchun o'ndan ortiq ChIP-qatlam boyitilgan bir nechta genlarning ekspression tahlili tekshirildi. Uch BdbZIP10-GFP OE liniyalari (uchta mustaqil transformatsiya hodisasidan) ushbu tahlil uchun bir xil ishlovdan o'tgan uchta WT zavodi (suv yoki paraquat bilan suv) bilan taqqoslandi.

RNK ekstraktsiyasi va miqdorini aniqlash

Uch BdbZIP10-GFP OE liniyalari (mustaqil transformatsiya hodisalaridan) gen ifodasini tahlil qilish uchun bir xil ishlovdan o'tgan WT o'simliklari bilan taqqoslandi. RNK ekstraktsiyasi Direct-zol™ RNK MiniPrep tizimi (Zymo Research Corp., Irvine, CA) yordamida amalga oshirildi. Qisqacha aytganda, 250 mg barg bo'laklari suyuq azotda maydalangan, Trizolga o'tkazilgan va keyin ishlab chiqaruvchining ko'rsatmalariga rioya qilgan holda DNase I hazm qilish bosqichini o'z ichiga olgan holda kolonnada tozalangan. Taxminan 3 mkg RNK ishlab chiqaruvchining ko'rsatmalariga rioya qilgan holda SuperScript® III Birinchi zanjirli sintez tizimi (Invitrogen) yordamida cDNK sintezi uchun ishlatilgan.

cDNK miqdorini aniqlash BioRad Real Time PCR aniqlash tizimi va Biorad iTaq™ Universal SYBR Green Supermix yordamida ishlab chiqaruvchining ko'rsatmalariga (Bio-Rad Laboratories, Hercules, CA) rioya qilgan holda amalga oshirildi. Primerlar QuantiPrime [35] yordamida veb-saytning standart sozlamalaridan foydalangan holda ishlab chiqilgan va chiziqlilik uchun sinovdan o'tgan. Ushbu tadqiqotda foydalanilgan primer ketma-ketliklari Qo'shimcha fayl 1da keltirilgan. RT-qPCR uchun, BdUBC18 normalizatsiya uy xo'jaligini nazorat qilish geni sifatida ishlatilgan [36] va qiyosiy CT ma’lumotlarni tahlil qilish uchun [37] usulidan foydalanilgan. Ifoda diapazoni DC ning standart og'ishi yordamida hisoblanganT Applied Biosystems tomonidan "Real-Time Kantitativ PCR yordamida gen ifodasini nisbiy miqdoriy aniqlashni amalga oshirish bo'yicha qo'llanma" [38] da tavsiflangan qiymat.


Minnatdorchilik

ENCODE konsortsiumini boshqarishda qoʻllab-quvvatlaganliklari uchun Judi R. Veksler va Julia Chjanga, ushbu loyihaning eksperimental va analitik qismlariga hissa qoʻshgan laboratoriyalarimiz va institutlarimizning qoʻshimcha aʼzolariga hamda JD Freyga yordam uchun minnatdorchilik bildiramiz. raqamlarni tayyorlashda.

ENCODE konsortsiumi mualliflari

Yozish guruhi. Richard M. Mayers 1 , Jon Stamatoyannopulos 2 , Maykl Snayder 3 , Ian Dunham 4 , Ross C. Hardison 5 , Bredli E. Bernshteyn 6,7 , Tomas R. Gingeras 8 , U. Jeyms Kent 9 , Yuan Birniya 4 , 10,11, Gregori E. Krouford 12,13.

Keng institut guruhi. Bredli E. Bernshteyn 6,7 , Charlz B. Epshteyn 6 , Noam Shoresh 6 , Jeyson Ernst 6,14 , Tarjei S. Mikkelsen 6 , Pouya Xeradpur 6,14 , Xiaolan Chjan 6 , Li Vang 6 , Robbin Iss Koyn 6 , Timoti Durem 6 , Manching Ku 6 , Tan Truong 6 , Lukas D. Uord 6,14 , Robert C. Altshuler 14 , Maykl F. Lin 6,14 , Manolis Kellis 6,14 .

Cold Spring Harbor Jeneva universiteti Genomik tartibga solish markazi, Barselona RIKEN Lozanna universiteti Genom instituti Singapur guruhi. Sovuq bahor bandargohi I: Tomas R. Gingeras 8 , Kerri A. Devis 8 , Filipp Kapranov 15 , Aleksandr Dobin 8 , Kristofer Zaleski 8 , Feliks Shlesinger 8 , Filipp Batut 8 , Sudipto Chakraborti 8 , Sonali Jha , Drenkoa 8w , Vey 8 , Dr. Van 8 , Kim Bell 8 , Xui Gao 16 , Ian Bell 15 , Erika Dyume 15 , Jaklin Dyume 15 . Jeneva universiteti: Stylianos E. Antonarakis 17, Ketrin Ucla 17, Christelle Borel 17. Genomik tartibga solish markazi, Barselona: Roderik Gigo 18 , Sara Djebali 18 , Julien Lagard 18 , Kolin Kingsvud 18 , Paolo Ribeka 18 , Micha Sammet 18 , Tayler Alioto 18 , Angelika Merkel 18 , Xagen Tilgner 18 . RIKEN: Piero Karninci 19 , Yoshixide Xayashizaki 19 , Timo Lassmann 19 , Xazuki Takaxashi 19 , Rehab F. Abdelhamid 19 . Sovuq bahor bandargohi II: Gregori Xannon 20 , Katalin Fejes-Tot 8 , Jonatan Preall 8 , Assaf Gordon 8 , Vihra Sotirova 8 . Lozanna universiteti: Aleksandr Reymond 21 , Sedrik Xovald 21 , Emilie Ait Yahya Graison 21 , Jaklin Khrast 21 . Singapur Genom instituti: Yijun Ruan 22 , Xiaoan Ruan 22 , Atif Shahab 22 , Wan Ting Poh 22 , Chia-Lin Vey 22 .

Dyuk universiteti, EBI, Texas universiteti, Ostin, Shimoliy Karolina universiteti – Chapel Hill guruhi. Dyuk universiteti: Gregori E. Krouford 12,13 , Terrens S. Fyuri 12 , Alan P. Boyl 12 , Natan C. Sheffild 12 , Lingyun Song 12 , Yoichiro Shibata 12 , Tereza Vales 12 , Debora Vinter 12 , Zhang Darcheng 12 , Z112 , Tianyuan Vang 12. EBI: Ewan Birney 4, Damian Kife 4. Texas universiteti, Ostin: Vishvanat R. Iyer 23, Bum-Kyu Li 23, Rayan M. MakDaniell 23, Zheng Liu 23, Anna Battenxaus 23, Akshay A. Bhinge 23. Shimoliy Karolina universiteti - Chapel Xill: Jeyson D. Lieb 24 , Linda L. Grasfeder 24 , Kimberli A. Duşlar 24 , Pol G. Giresi 24 , Seul K. C. Kim 24 , Kristofer Shestak 24 .

HudsonAlpha instituti, Kaltek, Stenford guruhi. HudsonAlpha instituti: Richard M. Myers 1 , Florensiya Pauli 1 , Timoti E. Reddi 1 , Jeyson Gertz 1 , E. Kristofer Partridge 1 , Preti Jeyn 1 , Rebekka O. Sprouz 1 , Anita Bansal 1 , Barbara Pusey 1 , Maykl A. Murate , Ketrin E. Varli 1 , Kevin M. Bouling 1 , Kimberli M. Nyuberi 1 , Emi S. Nesmit 1 , Jeyson A. Diloker 1 , Stefani L. Parker 1 , Lindsi L. Ueyt 1 , Krista Tibiault 1 , Kevin Roberts 1 , Devin M. Absher 1. Kaltek: Barbara Uold 10,11, Ali Mortazavi 10,11, Brayan Uilyams 10, Georgi Marinov 10, Dayan Trout 10, Shirli Pepke 25, Brandon King 10, Kennet MakKyu 10, Entoni, Kirilushail Gyoster Fisher 1010-1010 , Genri Amrhein 10, Jost Vielmetter 11. Stenford: Gavin Sherlok 3 , Arend Sidou 3,26 , Serafim Batzoglou 27 , Rami Rauch 3 , Anshul Kundaje 26,27 , Maks Libbrecht 27 .

NHGRI guruhlari. NHGRI, Genom informatika bo'limi: Elliott X. Margulies 28, Stiven C. J. Parker 28. NHGRI, Genomik funktsional tahlil bo'limi: Laura Elnitski 29. NHGRI, NIH Intramural Sequencing Center: Erik D. Green 30.

Sanger instituti Vashington universiteti Yel universiteti Genomik tartibga solish markazi, Barselona UCSC MIT Lozanna universiteti CNIO guruhi. Sanger instituti: Tim Xabbard 31 , Jennifer Xarrou 31 , Stiven Searl 31 , Feliks Kokosinski 31 , Brauen Aken 31 , Adam Frenkish 31 , Tobi Xant 31 , Gloriya Despasio-Reyes 31 , Mayk Kayu 31 , Gardje A 31 , Gayxer 31 , Gayxer 31 , Veronika Boychenko 31. Vashington universiteti: Maykl Brent 32, M. J. Van Baren 32, Randall X. Braun 32. Yel universiteti: Mark Gershteyn 33,34,35 , Ekta Khurana 33,34 , Suganti Balasubramanian 33,34 , Zhengdong Chjan 33,34 , Hugo Lam 33,34 , Filipp Kayting 3,33,34 , Rebekka Z3, Lu33 , Lu33 ,34. Genomik tartibga solish markazi, Barselona: Roderik Gigo 18 , Tomas Derrien 18 , Andrea Tanzer 18 , Devid G. Noulz 18 , Marko Mariotti 18 . UCSC: U. Jeyms Kent 9, Devid Xaussler 9,36, Reychel Xart 9, Mark Diekhans 9. MIT: Manolis Kellis 6,14, Mayk Lin 6,14, Pouya Kheradpour 6,14, Jeyson Ernst 6,14. Lozanna universiteti: Aleksandr Reymond 21 , Sedrik Xovald 21 , Emilie Ait Yahya Graison 21 , Jaklin Khrast 21 . CNIO: Alfonso Valensiya 37 , Maykl Tress 37 , Xose Manuel Rodriges 37 .

Stenford-Yel, Garvard, Massachusets universiteti tibbiyot fakulteti, Janubiy Kaliforniya universiteti/UCDavis guruhi. Stenford-Yel: Maykl Snayder 3 , Stiven G. Landt 3 , Debasish Raxa 38 , Minyi Shi 3 , Ghia Euskirchen 3 , Fabian Grubert 3 , Maya Kasovski 38 , Jin Lian 39 , Filip Kayting 3,33,34 , Fil Lakroute 33 , Xu83 , Xanna Monahan 38 , Dorrelin Patacsil 3 , Teri Slifer 3 , Xinqiong Yang 3 , Aleksandra Charos 38 , Brayan Rid 38 , Linfeng Vu 3 , Raymond K. Auerbax 33 , Lukas Xabegger exe Aloj 33 , Joy33 , Joy33 , Manowy 33 , Alexandra Charos Abyzov 33,34, Sherman M. Weissman 39, Mark Gerstein 33,34,35. Garvard: Kevin Struhl 40 , Natan Lamarre-Vinsent 40 , Marianne Lindahl-Allen 40 , Benoit Miotto 40 , Zarmik Moqtaderi 40 , Jozef D. Fleming 40 . Massachusets universiteti tibbiyot fakulteti: Piter Nyuburger 41. Janubiy Kaliforniya universiteti / UCDavis: Peggy J. Farnham 42,43, Set Frietze 42,43, Henriette O'Geen 43, Xiaoqin Xu 43, Kim R. Blahnik 43, Alina R. Cao 43, Sushma Iyengar 43.

Vashington universiteti, Massachusets universiteti tibbiyot maktabi guruhi. Vashington universiteti: Jon A. Stamatoyannopulos 2 , Rajinder Kaul 2 , Robert E. Turman 2 , Xao Vang 2 , Patrik A. Navas 2 , Richard Sandstrom 2 , Piter J. Sabo 2 , Molli Uiver 2 , Tereza Kanfild 2 , Kristen Li 2 Nef 2 , Vogan Rouch 2 , Aleks Reynolds 2 , Audra Jonson 2 , Erik Rayns 2 , Erika Giste 2 , Shinni Vong 2 , Jun Neri 2 , Tristan Frum 2 , Erik M. Jonson 2 , Erik D. Nguyen K 2 . Ebersol 2 , Minerva E. Sanches 2 , Hadar X. Sheffer 2 , Dimitra Lotakis 2 , Erik Xaugen 2 , Richard Humbert 2 , Tanya Kutyavin 2 , Toni Shafer 2 . Massachusets universiteti tibbiyot maktabi: Job Dekker 44, Bryan R. Lajoie 44, Amartya Sanyal 44.

Ma'lumotlarni muvofiqlashtirish markazi. U. Jeyms Kent 9 , Keyt R. Rozenblum 9 , Timoti R. Dreszer 9 , Brayan J. Reni 9 , Galt P. Barber 9 , Lorens R. Meyer 9 , Kriket A. Sloan 9 , Venkat S. Malladi 9 , Melissa S Cline 9 , Katrina Learned 9 , Vanessa K. Swing 9 , Enn S. Zweig 9 , Brooke Rhead 9 , Pauline A. Fujita 9 , Krishna Roskin 9 , Donna Karolchik 9 , Robert M. Kuhn 9 , David Haussler 9 , 36.

Ma'lumotlarni tahlil qilish markazi. Yuan Birni 4 , Ian Dunham 4 , Stiven P. Uaylder 4 , Damian Kife 4 , Daniel Sobral 4 , Xaver Errero 4 , Ketrin Bil 4 , Margus Lukk 4 , Alvis Brazma 4 Xuan M. Vaquerizas 4 , Nicholas 4 , Nicholas 4. Piter J. Bikel 45 , Natan Boley 45 , Jeyms B. Braun 45 , Qunxua Li 45 , Xaiyan Xuang 45 , Mark Gershteyn 32,33,34 , Lukas Xabegger 33 , Andrea Sboner 33,34 , Joel Rozov 3 , Ra3y K. Auerbax 33, Kevin Y. Yip 33,34, Chao Cheng 33,34, Kun-Kiu Yan 33,34, Nitin Bxardvay 33,34, Jing Vang 33,34, Lukas Lochovskiy 33,34, Jastin 34, Teodor Gibson 33,34, Jing Leng 33,34, Jiang Du 35, Ross Xardison 5, Robert S. Xarris 5, Giltae Song 5, Webb Miller 5, Devid Xaussler 9,36, Krishna Roskin 9, Bern Ting Vang 46 , Benedikt Paten 9 , Uilyam S. Nobl 2,47 , Maykl M. Xofman 2 , Orion J. Buske 2 , Zhiping Veng 48 , Xianjun Dong 48 , Jie Vang 48 , Hualin Xi 49 .

Albany universiteti SUNY guruhi. Skott A. Tenenbaum 50 , Frank Doyl 50 , Luiz O. Penalva 51 , Sridar Chittur 50 .

Boston universiteti guruhi. Tomas D. Tullius 52, Stiven C. J. Parker 28,52.

Chikago universiteti, Stenford guruhi. Chikago universiteti: Kevin P. Uayt 53 , Subhradip Karmakar 53 , Alek Viktorsen 53 , Nader Jamil 53 , Nik Bild 53 , Robert L. Grossman 53 . Stenford: Maykl Snayder 3 , Stiven G. Landt 3 , Xinqiong Yang 3 , Dorrelin Pataksil 3 , Teri Slifer 3 .

Massachusets universiteti tibbiyot maktabi guruhlari. Massachusets universiteti tibbiyot maktabi I: Job Dekker 44, Bryan R. Lajoie 44, Amartya Sanyal 44. Massachusets universiteti tibbiyot maktabi II: Zhiping Weng 48, Troy W. Whitfield 48, Jie Wang 48, Patrik J. Collins 54, Nathan D. Trinklein 54, E. Christopher Partridge 1, Richard M. Myers 1.

Boise shtat universiteti / Shimoliy Karolina universiteti - Chapel Hill Proteomik guruhi. Morgan C. Giddings 55,56,57, Xian Chen 58, Jaynab Khatun 55, Chris Maier 55, Yanbao Yu 57, Harsha Gunawardena 57, Brayan Risk 56.

NIH Loyiha boshqaruvi guruhi. Elise A. Feingold 58, Rebekka F. Loudon 58, Laura A. L. Dillon 58, Piter J. Yaxshi 58.

Aloqalar

1 HudsonAlpha Biotexnologiya instituti, Huntsville, Alabama, Amerika Qo'shma Shtatlari,

2 Genom fanlari boʻlimi, Vashington universiteti, Sietl, Vashington, Amerika Qoʻshma Shtatlari,

3 Genetika boʻlimi, Stenford universiteti tibbiyot fakulteti, Stenford, Kaliforniya, Amerika Qoʻshma Shtatlari,

4 Yevropa bioinformatika instituti (EMBL-EBI), Hinxton, Cambridgeshire, Buyuk Britaniya,

5 Qiyosiy genomika va bioinformatika markazi, Biokimyo va molekulyar biologiya boʻlimi, Pensilvaniya shtat universiteti, Universitet Parki, Pensilvaniya, Amerika Qoʻshma Shtatlari,

6 MIT va Garvard keng instituti, Kembrij, Massachusets, Amerika Qo'shma Shtatlari,

7 Xovard Xyuz tibbiyot instituti va Patologiya boʻlimi, Massachusets umumiy kasalxonasi va Garvard tibbiyot maktabi, Boston, Massachusets, Amerika Qoʻshma Shtatlari,

8 Cold Spring Harbor laboratoriyasi, Cold Spring Harbor, Nyu-York, Amerika Qo'shma Shtatlari,

9 Biomolekulyar fan va muhandislik markazi, Kaliforniya universiteti, Santa Cruz, Santa Cruz, Kaliforniya, Amerika Qo'shma Shtatlari,

10 Biologiya boʻlimi, Kaliforniya texnologiya instituti, Pasadena, Kaliforniya, Amerika Qoʻshma Shtatlari,

11 Bekman instituti, Kaliforniya texnologiya instituti, Pasadena, Kaliforniya, Amerika Qoʻshma Shtatlari,

12 Genom fanlari va siyosati instituti, Dyuk universiteti, Durham, Shimoliy Karolina, Amerika Qo'shma Shtatlari,

13 Pediatriya kafedrasi, Dyuk universiteti, Durham, Shimoliy Karolina, Amerika Qo'shma Shtatlari,

14 Kompyuter fanlari va sun'iy intellekt laboratoriyasi, Massachusets texnologiya instituti, Kembrij, Massachusets, Amerika Qo'shma Shtatlari,

15 Affymetrix, Santa Clara, Kaliforniya, Amerika Qoʻshma Shtatlari,

16 Karolinksa instituti, Huddinge, Shvetsiya,

17 Jeneva universiteti, Jeneva, Shveytsariya,

18 Bioinformatika va genomika, Center de Regulacio Genomica, Barselona, ​​Ispaniya,

19 Omiks ilmiy markazi, RIKEN Yokohama instituti, Yokogama, Kanagava, Yaponiya,

20 Xovard Xyuz tibbiyot instituti, Cold Spring Harbor laboratoriyasi, Cold Spring Harbor, Nyu-York, Amerika Qo'shma Shtatlari,

21 Integrativ genomika markazi, Lozanna universiteti, Lozanna, Shveytsariya,

22 Singapur Genom instituti, Singapur,

23 Tizimlar va sintetik biologiya markazi, Hujayra va molekulyar biologiya instituti, molekulyar genetika va mikrobiologiya boʻlimi, Ostindagi Texas universiteti, Ostin, Texas, Amerika Qoʻshma Shtatlari,

24 Biologiya bo'limi, Karolina genom fanlari markazi va Lineberger keng qamrovli saraton markazi, Chapel Hilldagi Shimoliy Karolina universiteti, Chapel Xill, Shimoliy Karolina, Amerika Qo'shma Shtatlari,

25 Ilg'or hisoblash tadqiqotlari markazi, Kaliforniya texnologiya instituti, Pasadena, Kaliforniya, Amerika Qo'shma Shtatlari,

26 Patologiya bo'limi, Stenford universiteti tibbiyot fakulteti, Stenford, Kaliforniya, Amerika Qo'shma Shtatlari,

27 Kompyuter fanlari boʻlimi, Stenford universiteti, Stenford, Kaliforniya, Amerika Qoʻshma Shtatlari,

28 Intramural tadqiqotlar bo'limi, Milliy inson genomi tadqiqot instituti, Milliy salomatlik instituti, Bethesda, Merilend, Amerika Qo'shma Shtatlari,

29 Milliy inson genomi tadqiqot instituti, genom texnologiyasi boʻlimi, Milliy salomatlik instituti, Rokvill, Merilend, Amerika Qoʻshma Shtatlari,

30 Milliy inson genomi tadqiqot instituti, NIH Intramural sekvensiya markazi, Milliy sog'liqni saqlash institutlari, Bethesda, Merilend, Amerika Qo'shma Shtatlari,

31 Umurtqali hayvonlar genom tahlili, Wellcome Trust Sanger instituti, Hinxton, Cambridgeshire, Buyuk Britaniya,

32 Genom fanlari markazi va Kompyuter fanlari boʻlimi, Sent-Luisdagi Vashington universiteti, Sent-Luis, Missuri, Amerika Qoʻshma Shtatlari,

33 Hisoblash biologiyasi va bioinformatika bo'yicha dastur, Yel universiteti, Nyu-Xeyven, Konnektikut, Amerika Qo'shma Shtatlari,

34 Molekulyar biofizika va biokimyo boʻlimi, Yel universiteti, Nyu-Xeyven, Konnektikut, Amerika Qoʻshma Shtatlari,

35 Kompyuter fanlari boʻlimi, Yel universiteti, Nyu-Xeyven, Konnektikut, Amerika Qoʻshma Shtatlari,

36 Xovard Xyuz tibbiyot instituti, Kaliforniya Santa Kruz universiteti, Santa Kruz, Kaliforniya, Amerika Qo'shma Shtatlari,

37 Strukturaviy hisoblash biologiyasi, Centro Nacional de Investigaciones Oncolùgicas, Madrid, Ispaniya,

38 Molekulyar, hujayrali va rivojlanish biologiyasi boʻlimi, Yel universiteti, Nyu-Xeyven, Konnektikut, Amerika Qoʻshma Shtatlari,

39 Genetika boʻlimi, Yel universiteti, Nyu-Xeyven, Konnektikut, Amerika Qoʻshma Shtatlari,

40 Biologik kimyo va molekulyar farmakologiya, Garvard tibbiyot maktabi, Boston, Massachusets, Amerika Qo'shma Shtatlari,

41 Massachusets universiteti tibbiyot fakulteti pediatriya bo‘limi, Vusster, Massachusets, Amerika Qo‘shma Shtatlari,

42 Biokimyo va molekulyar biologiya kafedrasi, Norris keng qamrovli saraton markazi, Janubiy Kaliforniya universiteti, Los-Anjeles, Kaliforniya, Amerika Qo'shma Shtatlari,

43 Genom markazi, Kaliforniya universiteti – Devis, Devis, Kaliforniya, Amerika Qoʻshma Shtatlari,

44 Gen funktsiyasi va ekspressiyasi bo'yicha dastur, Biokimyo va molekulyar farmakologiya bo'limi, Massachusets tibbiyot maktabi universiteti, Vusster, Massachusets, Amerika Qo'shma Shtatlari,

45 Berklidagi Kaliforniya universiteti Statistika boʻlimi, Berkli, Kaliforniya, Amerika Qoʻshma Shtatlari,

46 Sent-Luisdagi Vashington universiteti genetika boʻlimi, Sent-Luis, Missuri, Amerika Qoʻshma Shtatlari,

47 Kompyuter fanlari va muhandislik bo'limi, Vashington universiteti, Sietl, Vashington, Amerika Qo'shma Shtatlari,

48 Bioinformatika va integral biologiya bo'yicha dastur, Biokimyo va molekulyar farmakologiya bo'limi, Massachusets universiteti tibbiyot maktabi, Vusster, Massachusets, Amerika Qo'shma Shtatlari,

49 Bioinformatika dasturi, Boston universiteti, Boston, Massachusets, Amerika Qoʻshma Shtatlari,

50 Nano miqyosdagi fanlar va muhandislik kolleji, Albany universiteti-SUNY, Albany, Nyu-York, Amerika Qo'shma Shtatlari,

51 Bolalar saratoni tadqiqot instituti, Hujayra va strukturaviy biologiya bo'limi, San-Antonio, Texas, Amerika Qo'shma Shtatlari,

52 Kimyo va bioinformatika dasturi boʻlimi, Boston universiteti, Boston, Massachusets, Amerika Qoʻshma Shtatlari,

53 Genomika va tizimlar biologiyasi instituti, Chikago universiteti, Chikago, Illinoys, Amerika Qoʻshma Shtatlari,

54 SwitchGear Genomics, Menlo Park, Kaliforniya, Amerika Qoʻshma Shtatlari,

55 Biomolekulyar tadqiqot markazi, Boise shtat universiteti, Boise, Aydaho, Amerika Qo'shma Shtatlari,

56 Mikrobiologiya va immunologiya boʻlimi, Chapel Hilldagi Shimoliy Karolina universiteti, Chapel Hill, Shimoliy Karolina, Amerika Qoʻshma Shtatlari,

57 Biokimyo boʻlimi, Chapel Hilldagi Shimoliy Karolina universiteti, Chapel Hill, Shimoliy Karolina, Amerika Qoʻshma Shtatlari,

58 Milliy inson genomi tadqiqot instituti, Milliy salomatlik instituti, Bethesda, Merilend, Amerika Qo'shma Shtatlari


Videoni tomosha qiling: dna micro array animation (Iyul 2022).


Izohlar:

  1. Addison

    G'olibona variant :)

  2. Mazugis

    This topic only incomparably :), I like it.

  3. Dulrajas

    Bu birga. Va bu bilan men duch keldim.

  4. Bondig

    I recommend to you to come for a site where there is a lot of information on a theme interesting you.

  5. Nikogal

    Hatto, cheksiz

  6. Wulfsige

    Men uning nuqtai nazarini to'liq baham ko'raman. Menimcha, bu ajoyib g'oya. U bilan to'liq rozi.



Xabar yozing