Ma `lumot

Xamirturushlarni etishtirish usulida usul belgilarining aniqlanishi

Xamirturushlarni etishtirish usulida usul belgilarining aniqlanishi



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Men xamirturush madaniyati va usullari haqida maqolani o'qiyapman, unda shunday deyilgan:

Keyin $5$ ml steril $M/15 KH_2PO_4$, nishabga qo'shildi,

Ma'nosi nima $M/15$?


Penitsilium: tavsifi, tuzilishi va ko'payishi

Penicillium saprofit qo'ziqorin bo'lib, ko'k yoki yashil mog'or sifatida tanilgan. Raper va Tom (1949) ma'lumotlariga ko'ra, jinsga butun dunyo bo'ylab tarqalgan 136 tur kiradi. Ular tuproqda, havoda, chirigan meva, sabzavotlar, go'sht va boshqalarda mavjud.

Penitsillin birinchi marta 1929 yilda Londonning Sant-Meri kasalxonasida ser Aleksandr Fleming tomonidan qaynoq, karbunkul, yaralarda sepsis, kuyishlar va boshqalar uchun javobgar bo'lgan Staphylococcus aureus bakteriyasi bilan ishlaganda kashf etilgan. mog'or sporasi bilan (Penicillium notatum) to'g'ri o'sgandan so'ng 5. aureusning o'limiga olib keladi, uning atrofida litik zonani ko'rsatadi.

U ushbu mikroblarga qarshi va mikroblarga qarshi birikmani ajratib oldi va Penitsillin deb atadi. Keyinchalik Raper va Aleksandr (1945) penitsillin ishlab chiqarishda P. notatumga qaraganda samaraliroq P. crysogenum shtammini tanladilar. Penicilliumning ahamiyati 4.6-jadvalda keltirilgan.

Vegetativ tuzilishi Penitsilium:

Vegetativ tanasi miseliydir (4.42A, B-rasm). Miseliy birdan ko'p yadroli yupqa devorli hujayralardan tashkil topgan septali gifalar bilan ko'p tarmoqlangan (4.42C-rasm). Har bir septum markaziy teshikka ega bo'lib, u orqali sito-shiplazmatik uzluksizlik saqlanadi.

Ba'zi mitseliyalar oziq-ovqat materialini o'zlashtirish uchun substratga chuqurroq kirib boradi, boshqalari esa substratda qoladi va mitselial kigizni o'sadi. Zaxira oziq-ovqat yog 'globulalari shaklida mavjud.

Qayta ishlab chiqarish Penitsilium:

Penitsilium vegetativ, jinssiz va jinsiy yo'llar bilan ko'payadi.

1. Vegetativ ko‘payish:

Bu vegetativ mitseliyning tasodifiy ikki yoki undan ortiq bo'laklarga bo'linishi natijasida sodir bo'ladi. Keyin har bir parcha ona mitseliysi kabi alohida o'sadi.

2. Jinssiz ko‘payish:

Jinssiz koʻpayish bir hujayrali, bir yadrosiz, harakatsiz sporalar, konidioforda hosil boʻlgan konidiyalar orqali sodir boʻladi (4.43-rasm).

Konidiofor vegetativ mitseliyning istalgan xujayrasidan tik shoxcha sifatida rivojlanadi. Konidiofor shoxlanmagan bo'lishi mumkin (P. spinulosum, P. thomii) yoki turli xil shoxlangan bo'lishi mumkin (P. expansum). Konidioforning shoxchasi (4.44B-rasm) ramus (ko'plik rami) deb nomlanadi, u keyinchalik shoxlangan bo'lib, metulae deb nomlanadi. Har bir metulaning uchida bir qancha kolba shaklidagi fialid yoki sterigmata rivojlanadi.

Har bir sterigmata o'zining uchida bazipetal tarzda joylashgan bir qancha konidiyalar hosil qiladi (kichigi ona yaqinida va kattasi undan uzoqda). Tarmoqsiz konus va shidioforli turlarda (P. spinulosum) sterigmata konidioforning uchida rivojlanadi. Kamdan-kam hollarda (P. claviforme) ko'pgina konidioforlar birlashib, koremiosporlar deb ataladigan konidiyalarni rivojlantiradigan koremiy deb ataladigan to'psimon meva hosil qiladi.

Konidiy rivojlanishi jarayonida sterigmaning uchi shishib, yadrosi mitotik tarzda ikkita yadroga bo'linadi, ulardan biri shishgan uchiga ko'chib o'tadi va bo'linish devori orqali shishgan hudud onadan uzilib, bir yadrosiz konidiyni hosil qiladi.

Sterigmaning uchi yana shishadi va xuddi shu tartibda ikkinchi konidium hosil bo'lib, birinchisini tashqi tomonga itaradi. Bu jarayon bir necha marta takrorlanadi va shuning uchun konidiyalar zanjiri hosil bo'ladi.

Konidiyalar (4.44C-rasm) oval, elliptik yoki sharsimon tuzilishga ega bo'lib, tashqi yuzasi silliq, qo'pol, ekinulyatsiyalangan va yashil, sariq, ko'k va boshqalar kabi turli xil ranglarga ega.

Pishganidan keyin konidiyalar onadan ajraladi va shamol tomonidan tarqaladi. Tegishli substratda ular mikrob naychasini ishlab chiqish orqali unib chiqadi (4.44D-rasm). Yadro takroriy mitotik bo'linishni boshdan kechiradi va barcha yadrolar germ naychasiga kiradi. Septa hosil bo'lishi germ naychasining cho'zilishi bilan davom etadi va nihoyat yangi septali shoxlangan mitseliy rivojlanadi.

3. Jinsiy ko‘payish:

Jinsiy ko'payish faqat bir nechta turlarda o'rganilgan (4.44-rasm). U izogamiya (P. bacillosporum), oogamiya (P. vermiculatum) dan somatogamiya (P. brefeldianum)gacha katta o'zgarishlarni ko'rsatadi. Turlarning aksariyati gomotalik, P. luteum kabi bir nechta turlaridan tashqari, geterotalikdir. Askokarplar kamdan-kam hosil bo'ladi. Askokarplar asosida turli avlodlarni Europenicillium, Talaromyces va Carpenteles deb belgilash mumkin.

Talaromyces jinsi 15 turdan iborat. Talaro­mycesning o'rganilgan barcha turlari gomotalikdir. Jinsiy ko'payish haqidagi hisob Talaromyces vermiculatus (= Penicillium vermiculatum) bilan bog'liq, Dangeard (1907) tomonidan tasvirlangan. Ushbu tezlik jinsiy ko'payishning oogamous turini ko'rsatadi. Ayol va erkak jinsiy a'zolari mos ravishda ascogonium va antheridium’.

Askogonium vegetativ filamentning istalgan hujayrasidan tik bir yadrosiz va bir hujayrali tana sifatida rivojlanadi (4.44-rasm). Keyin yadro qayta-qayta mitotik bo'linishlarga uchraydi va 32 yoki 64 yadro hosil qiladi (4.44-rasm).

Anteridium har qanday qo'shni gifadan askogonium bilan bir vaqtda rivojlanadi (4.44-rasm). U, shuningdek, askogonium atrofida o'ralgan bir yadrosiz va bir hujayrali va uyali shoxdir. Anteridial shoxning apikal sohasi septum bilan kesiladi va qisqa, bir oz shishgan bir va bir hujayrali va bir yadrosiz anteridium hosil qiladi (4.44-rasm).

Askogonium ham, anteridium ham yetilgandan keyin anteridiumning uchi egilib, askogonial devorga tegib turadi. Aloqa nuqtasidagi umumiy devor parchalanadi va ikkita sitoplazma keyin aralashadi.

.anteridiumning yadrosi askogoniumga o'tmaydi (4.44H-rasm) (Dangeard, 1907). Keyinchalik, yadrolarning askogoniumga juftlashishi faqat askogonial yadrolar tomonidan amalga oshiriladi. Keyin askogonium bo'linish devori orqali ko'plab binokulyar va shiat hujayralariga bo'linadi, bir qatorli joylashadi (4.44-rasm).

Ascogo&shiniumning ba'zi ikki yadroli hujayralari ko'p hujayrali va uyali askogen shoxlangan gifalar hosil bo'lishi orqali tashqariga chiqadi, ularning hujayralari ham dikaryotikdir (4.441-rasm). Dikariyotik mitseliyalarning apikal hujayralari shishib, askus ona hujayralari vazifasini bajaradi (4.44-rasm).

Askus ona hujayraning ikkala yadrosi ham kariogamiyaga uchraydi va diploid (2n) yadro hosil qiladi (4.44K-rasm). Keyin yadro avval meiozga, so'ngra mito&shisisga o'tadi, natijada 8 ta yadro hosil bo'ladi, ular bir oz sitoplazma to'plangandan keyin 8 ta askosporani hosil qiladi (4.44-rasm).

Ascogonium va anteridium rivojlanishi bilan ko'plab steril gifalar asta-sekin ular bilan chigallashadi va nihoyat askosporalar shakllangandan so'ng, umumiy struktura yumaloq meva tanasiga, ya'ni kleistotsiyga aylanadi (4.44-rasm). Asci kleistotsiy ichida tartibsiz joylashadi. Askosporalar sharsimon, elliptik yoki lentikulyar shaklda silliq, echinuklesimon, chuqurchaga o'ralgan (4.44-rasm) yoki lateral ko'rinishida g'ildirak kabi shoxlangan tashqi devorga ega bo'lishi mumkin.

Askosporalar askus va kleistotsiy devorining parchalanishi natijasida chiqariladi. Askospora mos substratda germ naychasini ishlab chiqish orqali unib chiqadi (4.440-rasm) va oxir-oqibatda ona kabi mitseliyga aylanadi.


Objective-C-da mulkka kirish uchun nuqta belgisi hisoblanadi xabar yuborish, xuddi qavs belgisi kabi. Ya'ni, buni hisobga olgan holda:

Oxirgi ikkita satr aynan bir xil tuziladi. Buni o'zgartiradigan yagona narsa, agar xususiyatda qabul qiluvchi va/yoki sozlash atributi ko'rsatilgan bo'lsa, u faqat xabar yuborilganligini emas, balki qaysi xabar yuborilishini o'zgartiradi:

Oxirgi ikki satrning ikkalasi ham xuddi shunday kompilyatsiya qilinadi.

Kakao mening qiz do'stim maqolasini ko'rib chiqing. Buning mohiyati shundan iboratki, ulardan birini boshqasidan foydalanganda ishlash uchun jazo yo'q.

Biroq, belgi sizning o'zgaruvchilaringiz bilan nima sodir bo'layotganini va o'zgaruvchilaringiz nima ekanligini ko'rishni qiyinlashtiradi.

Agar siz xususiyatni "noatomik" deb belgilamasangiz, unumdorlik farqini ko'rasiz. Keyin @synthesize avtomatik ravishda mulkingiz sozlamalari atrofida sinxronizatsiya kodini qo'shib, uni tarmoq xavfsizligini ta'minlaydi - lekin sozlash va kirish uchun sekinroq.

Shunday qilib, ko'pincha siz quyidagi xususiyatni belgilashni xohlaysiz:

@property (noatomik, saqlash) NSString *myProp

Shaxsan men nuqta belgilarini to'g'ri sozlash usullarini yozish haqida o'ylamaslik nuqtai nazaridan foydali deb bilaman, bu hatto atom bo'lmagan sozlagichlar uchun ham unchalik ahamiyatsiz emas, chunki siz eski qiymatni to'g'ri chiqarishni ham unutmasligingiz kerak. Shablon kodidan foydalanish yordam beradi, lekin siz har doim xatoga yo'l qo'yishingiz mumkin va bu odatda takrorlanadigan kod bo'lib, sinflarni chalkashtirib yuboradi.

Xabardor bo'lishi kerak bo'lgan namuna: agar siz sozlagichni o'zingiz aniqlasangiz (uni @synthesize ga yaratishga ruxsat berish o'rniga) va qiymatni o'rnatishning boshqa nojo'ya ta'sirlarini boshlasangiz, ehtimol xususiyat belgisidan foydalanib chaqirish o'rniga sozlashni oddiy usulga aylantirishingiz kerak.

Xususiyatlardan semantik foydalanish qo'ng'iroq qiluvchiga haqiqiy qiymatga to'g'ridan-to'g'ri kirish kabi ko'rinadi va undan farq qiladigan har qanday narsa xususiyatga kirish emas, balki xabar yuborish orqali amalga oshirilishi kerak (garchi ular haqiqatan ham xabar yuborayotgan bo'lsa ham).


3. Qadimgi cho'yanlarni yuvish vositalari

19 va 20-asrlarda ba'zi spirtli ichimliklar ishlab chiqaruvchi zavodlar muqobil variantlarni qidirdilar. Ular tozalash osonroq bo'lgan materiallardan foydalanishni va uzoqroq ishlash muddatini ta'sir qilishni xohlashdi. Quyma temir bu asrlarning javobi edi va bir nechta distillash zavodlarida siz hali ham bunday og'ir yuvish vositalarini ko'rishingiz mumkin.

Alt a Bhaine-da quyma temir yuvish vositalari


Patentlar

Asosiy ma'lumot va qidiruv mezonlari

Patent - bu texnik ma'lumotlarni tavsiflovchi huquqiy hujjat. Ushbu sharh bir xil asosiy ixtironi tavsiflovchi xususiyatlarni birlashtirgan "patent oilalari" ga asoslangan. Ushbu mavzu bo'yicha boshqa sharhlardan farqli o'laroq (Gélinas 2009 2010a 2010b), bu tegishli patentlar nashr sanasiga emas, balki eng erta topshirish sanasiga ko'ra taqdim etiladi. Bu tegishli ixtirolarning ustuvorligini aniqlashga, asl ixtirochilarni kuzatishga va texnologiya tendentsiyalari va ixtirochilarning rag'batlarini vaqt bo'yicha yaxshiroq baholashga yordam berdi. Ushbu sharhni tayyorlash jarayonida Germaniya va Avstriya kabi mamlakatlarda hujjatlarni topshirish sanalari va nashr sanalari o'rtasida katta kechikishlar bo'lganligi aniqlandi, ba'zan 5 yildan ortiq, ayniqsa Birinchi Jahon urushi va Ikkinchi Jahon urushi davrida 1914 yildan 1918 yilgacha va 1939-1945 yillar.

Bir nechta patent idoralarida 1900 yildan keyin taqdim etilgan spetsifikatsiyalarda oshkor qilingan ixtirolarning ustuvorligi odatda patentlarni qabul qilish va chop etishdan oldin tekshirilgan. Biroq, Buyuk Britaniyada (GB) qabul qilinmagan patentlarning spetsifikatsiyalari 1883 yilgacha nashr etilgan, ammo 1924 yilda chiqarilgan bitta qabul qilinmagan GB patentining to'liq spetsifikatsiyasi topilgan (GB 192085). Ariza berish sanasi 1916 yildan oldinroq bo'lgan GB patentlari ham ariza berilgan yil (nashr qilingan yili emas) va seriya raqami bo'yicha aniqlangan, keyin esa yangi va doimiy raqamlangan ketma-ketlik kiritildi (Rimmer va Van Dulken 1992).

Ushbu sharh xamirturush texnologiyasi haqida to'liq ma'lumot berishga urinmadi, chunki patentlar umumiy ixtirolarning faqat bir qismini tashkil qiladi. Bu boshqa joylarda yoritilgan (Reed and Nagodawithana 1991 Gélinas 2006). Patentlar, ayniqsa, 1900 yildan 2009 yilgacha xamirturush ishlab chiqarish sanoatidagi manfaatlar va tashvishlar evolyutsiyasining imtiyozli va o'z vaqtida isboti sifatida ko'rilgan. Bu ish, shuningdek, 1900 yilgacha nashr etilgan patentlarni ko'rib chiqishni yakunlaydi (Gélinas 2010a). Patentlarning aksariyati [email protected] va Depatis kabi ma'lumotlar bazalarida qidirish orqali olingan. Ba'zi frantsuz patentlari INPI (Institut Natl. de la Propriété Intellectuelle, Parij) orqali buyurtma qilingan. Metodologiya bo'yicha batafsil ma'lumot Gélinas (2010a) da keltirilgan. Ushbu ko'rib chiqish tugashi bilanoq, Vagner (1936) tomonidan nashr etilgan kitobga kirish mumkin edi, unda 1936 yilgacha novvoy xamirturushlari bo'yicha berilgan ko'plab patentlarning qisqacha ma'lumotlari mavjud.


Protein ifodasi

Rekombinant oqsillarni ifodalash, ayniqsa bakterial vektorlar va xostlar yordamida, etuk texnologiyadir. Tegishli cDNK va PCR usullari bilan ekspressiv plazmidlar tezda ishlab chiqarilishi mumkin. Konstruksiyalarning ketma-ketligini aniqlagandan so'ng, plazmidlar ekspressiv xostlarga aylanadi, bitta koloniyalar olinadi va fermentatsiya amalga oshiriladi. Bilan E. coli, murakkab vositalar yordamida 2 litrli fermentatsiya hosil bo'ladi

50 dan 80 g gacha (hujayralarning nam og'irligi). Oddiy protein ifodasini (jami hujayra oqsilining 2% dan 5% gacha) deb hisoblasak, hujayralarda 100 dan 300 mg gacha rekombinant oqsil mavjud. Muammo, albatta, uni faol shaklda qanday qilib izolyatsiya qilishdir. Eriydigan oqsillarni yaxshi rentabellik bilan olish mumkin (㹐%), erimaydigan oqsillarni esa denaturatsiya va katlama siklidan o'tishi kerak bo'lsa, oddiyroq hosildorlik bilan (5% dan 20% gacha) tiklanishi mumkin. Shunday qilib, kichik miqyosdagi fermentatsiyalar va laboratoriya miqyosidagi qayta ishlash uskunalari yordamida oqsillarni (yoki ularning subdomenlarini) ko'p tadqiqotlarni, shu jumladan batafsil strukturaviy aniqlashlarni boshlash uchun odatda etarli miqdorda (10 dan 100 mg gacha) ishlab chiqarilishi mumkin. Genlarning yuqori darajadagi ifodalanishiga erishish uchun ba'zi strategiyalar E. coli Markrides (1996) va Baneyx (1999) tomonidan ko'rib chiqilgan va 5.24 bo'limida ham muhokama qilingan.

Yuqoridagi xususiyatlarning ba'zilari xamirturush va bakulovirus eukaryotik ekspresyon tizimlaridan foydalangan holda oqsillarni ishlab chiqarish uchun ham amal qiladi, ammo vektorlarni yaratish va bakulovirus tizimi bilan qayta ishlash uchun hujayralarni ishlab chiqarish uchun ko'proq kuch va tajriba talab etiladi. Xamirturushlarni ifodalash tizimi bakteriyalarda erimaydigan qo'shimchalar hosil qiluvchi oqsillar va membrana bilan bog'langan oqsillarni ishlab chiqarish uchun oqilona tanlov bo'lishi mumkin (Cereghino va Clegg, 1999 UNITS 5.6𠄵.8). Baculovirus tizimi fosforlangan oqsillar va glikoproteinlar (Kost, 1999 UNITS 5.4𠄵.5) ishlab chiqarish va o'zaro ta'sir qiluvchi oqsillarni birgalikda ifodalash uchun juda foydali ekanligini isbotladi. Barqaror sutemizuvchilar oqsilini ifodalovchi vektorlarni yaratish ancha ko'proq vaqt va kuch talab qiladi, ammo murakkab ko'p domenli oqsillarni ishlab chiqarish uchun yagona yondashuv bo'lishi mumkin (UNITS 5.9 𠄵.10). Hujayra zichligi 1 𠄵 휐 9 hujayra/ml gacha o'sadigan hujayralar odatda 㸐 mg/litr mahsulot ajratishi mumkin. Shu bilan bir qatorda, turli virusli vektorlardan (masalan, vaccinia virus UNITS 5.12𠄵.15) foydalanadigan vaqtinchalik gen ekspresyon tizimlaridan kam miqdorda protein ishlab chiqarish uchun foydalanish mumkin, bu esa texnik-iqtisodiy tadqiqotlar uchun foydalidir. Shunisi qiziqki, sutemizuvchilar hujayralaridagi keng ko'lamli vaqtinchalik ekspressiya tizimlari biotexnologiya kompaniyalari tomonidan faol ishlab chiqilmoqda (Vurm va Bernard, 1999).

Rekombinant oqsillarni ishlab chiqarish uchun xost tizimini tanlash 5.16 bo'limida muhokama qilinadi va Brondyke (2009) tomonidan ham qisqacha umumlashtiriladi. Shuningdek, jurnalda rekombinant oqsillarni ishlab chiqarish bo'yicha maxsus nashr mavjud Biotexnologiya yutuqlari (Sanches va Demin, 2012). Ushbu sonda oqsillarni ifodalash va ulardan foydalanish bo'yicha ajoyib sharhlar mavjud E.coli (Chen, 2012) xamirturush (Celik va Calik, 2012) hasharotlar hujayrasi va bakulovirus tizimi (Drugmand va boshq 2012), sutemizuvchilar hujayralari (Zhu, 2012) hujayrasiz tizimlar (Karlson va boshq., 2012) va o'simlik hujayralari (Xu va boshq. ., 2012).

Chen (2012) ta'kidlaganidek, ko'plab tadqiqotchilar uchun birinchi tanlov ko'pincha Escherichia coli Laboratoriya tadqiqotlari va tijorat faoliyatida dastlabki ishlab chiqish uchun afzal qilingan tizim bo'lib qolmoqda va boshqa turli ifoda platformalari bilan taqqoslash uchun etalon hisoblanadi. Bu genetik manipulyatsiya qulayligi, optimallashtirilgan ekspressiv plazmidlarning mavjudligi va o'sish qulayligi kabi omillarga bog'liq. Ushbu bo'limda ifodalangan oqsillarga alohida urg'u berib, rekombinant oqsillarni tozalashning umumiy ko'rinishi keltirilgan. E. coli. Amaliy jihatlar va strategiyalar butun davomida ta'kidlanadi va iloji bo'lsa, muhokama 6-bobning qolgan qismida tasvirlangan misol protokollariga o'zaro havola qilinadi.

Birinchi bo'lim cDNK ketma-ketligini tarjima qilish natijasida olinishi mumkin bo'lgan oqsillarni tozalash bilan bog'liq ma'lumotlar bilan bog'liq. Shundan so'ng bakterial oqsillarni ifodalash bilan bog'liq ba'zi umumiy muammolarning qisqacha muhokamasi (shuningdek, UNIT 5.1 ga qarang). Proteinni tozalash strategiyasini rejalashtirish, ifodalangan mahsulotning eruvchanligini aniqlashni talab qiladi, shuningdek, oqsilning hujayradagi, masalan, sitoplazmada yoki periplazmada joylashishini aniqlash foydali bo'ladi. Ushbu bo'lim bakterial ishlab chiqarilgan oqsillarning eruvchanligini va lokalizatsiyasini o'rnatish uchun yondashuvlarni umumlashtiruvchi oqim jadvallarini o'z ichiga oladi (shuningdek, UNIT 5.2 ga qarang).

Eriydigan va erimaydigan oqsillarni tozalash strategiyalari ko'rib chiqiladi va oqim jadvallarida umumlashtiriladi (shuningdek, 1-bobga qarang). Ko'pgina individual tozalash bosqichlari, ayniqsa xromatografiya bilan bog'liq bo'lganlar 8 va 9-boblarda va boshqa joylarda batafsil yoritilgan (Scopes, 1994 Janson, 2011). Bu yerda tasvirlangan metodologiya va yondashuvlar asosan laboratoriya miqyosidagi operatsiyalar uchun mos keladi. Katta miqyosli metodologiyalar ilgari ko'rib chiqilgan (Asenjo va Patrick 1990 Thatcher, 1996 Sofer and Hagel, 1997).

Bakteriyalarda glikozillanmagan holatda ishlab chiqarilgan glikoproteinlar bo'limi, ular in vivo tadqiqotlar uchun foydali bo'lmasa-da, bunday oqsillar strukturaviy tadqiqotlar uchun juda mos ekanligini ta'kidlash uchun kiritilgan. Yakuniy bo'limlar oqsillarni qayta ishlash, tozalash miqyosi va maqsadlari va rekombinant oqsillarni tozalash va tavsiflash uchun zarur bo'lgan maxsus uskunalar bilan bog'liq.


Ilmiy usul qanday ishlaydi

Shubhasiz, ilmiy usul kuchli vositadir, lekin uning cheklovlari bor. Bu cheklovlar gipoteza tekshirilishi va soxtalashtirilishi hamda tajriba va kuzatishlarning takrorlanishi mumkinligiga asoslanadi. Bu ma'lum mavzularni ilmiy uslubdan tashqariga qo'yadi. Ilm-fan Xudoning yoki boshqa g'ayritabiiy mavjudotning mavjudligini isbotlay olmaydi yoki rad eta olmaydi. Ba'zida ilmiy asoslar ba'zi ilmiy bo'lmagan g'oyalarga ishonchlilik berish uchun ishlatiladi, masalan aqlli dizayn. Aqlli dizayn - bu koinot va hayotning paydo bo'lishining ba'zi jihatlarini faqat aqlli, ilohiy kuch kontekstida tushuntirish mumkin degan da'vo. Aqlli dizayn tarafdorlari ushbu kontseptsiyani davlat maktablari o'quv dasturlarini ishlab chiquvchilarga yanada yoqimli qilish uchun ilmiy nazariya sifatida o'tkazishga harakat qilishadi. Ammo aqlli dizayn ilm emas, chunki ilohiy mavjudotning mavjudligini tajriba bilan sinab ko'rish mumkin emas.

Fan ham qimmatli xulosalar chiqarishga qodir emas. Masalan, global isishni yomon deb ayta olmaydi. U global isishning sabablari va oqibatlarini o'rganishi va bu natijalar haqida hisobot berishi mumkin, ammo u SUVlarni haydash noto'g'ri yoki oddiy lampochkalarini ixcham lyuminestsent lampalar bilan almashtirmagan odamlar mas'uliyatsiz deb da'vo qila olmaydi. Ba'zida ba'zi tashkilotlar o'zlarining sabablarini ilgari surish uchun ilmiy ma'lumotlardan foydalanadilar. Bu ilm-fan va axloq o'rtasidagi chegarani yo'qotadi va mahsulot yoki g'oyani jiddiy sinovdan o'tmagan da'vo bilan qonuniylashtirishga harakat qiladigan "pseudo-fan" ni yaratishni rag'batlantiradi.

Va shunga qaramay, to'g'ri ishlatilsa, ilmiy usul insoniyat yaratgan eng qimmatli vositalardan biridir. Bu bizga uy atrofidagi kundalik muammolarni hal qilishda yordam beradi va shu bilan birga, biz yashayotgan dunyo va koinot haqidagi chuqur savollarni tushunishga yordam beradi.

Ko'pincha ikkita raqobatchi nazariya bitta hodisani tasvirlash uchun mavjud emas. Ammo yorug'lik holatida bitta nazariya etarli emas. Ko'pgina tajribalar yorug'lik uzunlamasına to'lqin kabi harakat qiladi degan fikrni qo'llab-quvvatlaydi. Birgalikda olib borilgan bu tajribalar yorug'likning to'lqin nazariyasini keltirib chiqardi. Biroq, boshqa tajribalar yorug'lik o'zini zarracha sifatida tutadi degan fikrni qo'llab-quvvatlaydi. Bir nazariyani rad etish va ikkinchisini saqlab qolish o'rniga, fiziklar yorug'lik harakatini tasvirlash uchun to'lqin/zarracha ikkilikni saqlab qolishadi.


Mikroorganizmlarning tasnifi | Mikrobiologiya

Quyidagi fikrlar mikroorganizmlarni tasniflashning uchta asosiy tizimini ta'kidlaydi. Tasniflash tizimi quyidagilardan iborat: 1. Besh shohlik tasniflash tizimi 2. Sakkizta qirollik tasniflash tizimi 3. Tasniflashning uchta domen tizimi.

1. Besh qirollik tasnifi tizimi:

Keyinchalik hujayra anatomiyasi asosida prokaryotik va eukariot organizmlar ajratildi va bakteriyaning prokaryotik organizm sifatidagi tushunchasi mikrobiologiyada 1962 yilda Stamir va Van Niel tomonidan asos solingan. 1969 yilda Uittaker barcha organizmlar uchun o'simliklar, zamburug'lar, hayvonlar, protistalar va moneralar qirolligidan iborat beshta qirollik tizimini taklif qildi (2.3-rasm), ularning energiya ishlab chiqarish tizimlari va hujayra anatomiyasi asosida.

Yuqorida tavsiflangan umumiy belgilarga ega mikroorganizmlar monera, protista, zamburug'lar va o'simliklarning bir qismi qirolliklarida tarqalgan. So'nggi paytlarda ribosoma RNK ketma-ketligi va boshqa ma'lumotlar asosida tirik organizmlarning evolyutsion munosabatlari aniqlandi.

Prokariotlarning Monera qirolligi barcha prokaryotik mikroorganizmlarni o'z ichiga oladi. Protista bir hujayrali yoki ko'p hujayrali eukaryotik organizmlardan iborat, ammo haqiqiy to'qimalar yo'q. Qo'ziqorinlar qirolligi eukaryotik va ko'p yadroli organizmlarni o'z ichiga oladi.

A'zolar singdiruvchi ovqatlanish rejimiga ega. Animalia tarkibida hujayra devoridan mahrum bo'lgan ko'p hujayrali hayvonlar mavjud. Yutish - bu ovqatlanish usuli. Plantae qirolligiga ko'p hujayrali eukariotlar kiradi. Ularning oziqlanish usuli fotosintezdir.

2. Tasniflash va shifolashning sakkizta qirollik tizimi:

Kavaler-Smit (1987, 1993) hujayra va genetik tashkilotlarning ultrastrukturasi (rRNK ketma-ketligi va boshqa ma'lumotlar) asosida protistlarni sakkizta qirollikka ajratdi. U barcha organizmlarni ikki imperiyaga (Bakteriyalar va Eukariotalar) ajratdi (2.4-rasm). Bakteriyalar imperiyasi ikkita qirollikni o'z ichiga oladi (Eubakteriyalar va Arxeobakteriyalar). Eukaryota imperiyasi oltita qirollikni o'z ichiga oladi (Archezoa, Protozoa, Plantae, Chromista, Fungi va Animalia).

Chromista qirolligiga diatomlar, jigarrang suv o'tlari, kripto-monadlar va oomitsetler kiradi. Chromista a'zolari fotosintetikdir va ularning xromoplastlari endoplazmatik retikulumning lümeninde joylashgan, ammo sitoplazmada emas.

3. Tasniflashning uchta domen tizimi:

Woese (1990) bakteriyalar o'simliklar va hayvonlardan uzoqda va aksincha, o'simliklar va hayvonlar bir-biridan unchalik uzoq emasligini ta'kidladi. Shuning uchun ular podshohlik ustidan yangi ustun domenlar kontseptsiyasini o'rnatdilar va 1991 yilda uchta domen, Bakteriyalar, Arxeya va Eukariyani taklif qildilar (2.5-rasm).

2.5-rasm: 16S yoki 18S ribosomali RNKning qiyosiy ketma-ketligidan olingan universal filogenetik daraxt.

Arxeya va Eukariya domenlari bir-biri bilan aniq bog'langan. Eukariya membrana lipidlari va eukaryotik rRNK sifatida glitserin yog'li atsil-diesterga ega bo'lgan organizmlarni o'z ichiga oladi. Domen Bakteriyalar membrana lipidlariga ega bo'lgan diatsil glitserin diesterlari va eubakterial rRNK kabi a'zolardan iborat.

Archaea domenining mem­beri ularning membranasidagi izoprenoid glitserin diester (yoki diglitserin tetraeter) lipidlaridan va arbakterial rRNKdan iborat.

Zamonaviy ma'noda bakteriyalar, siyanobakteriyalar, aktinomitsetlar va boshqalar domenda tarqaladilar bakteriyalar metanogenlar o'ta termofil organizmlar, o'ta galofil organizmlar va boshqalar arxeya va mog'orlar, xamirturushlar, bazidiomitsetlar, suv o'tlari va protozoyalar va boshqalar. domeni Eukaria. Mikroorganizmlar evolyutsion turli organizmlarning to'plami sifatida qaraladi.


Uni xavfsiz joyga ko'chiring

Shisha to'liq to'ldirilgandan so'ng, biz xamirturush shakarining butun tajribasini lavaboga o'tkazdik. Pufakchalar sekin harakatlanar edi va o'zimizni tashvishga soladigan hech narsa yo'q edi, lekin N balonni tortib olib, shishaning tepasiga asta-sekin quyilgan ko'pikni tomosha qilishni yoqtirardi.


Materiallar va uslublar

Maksimal ehtimollik moslashuvi protsedurasi (2D-rasm) MATLABda amalga oshirilgan va manba kodi https://github.com/gerland-group/PHO5_on-off-slide_models manzilida mavjud.

Maksimal ehtimollik mos keladi

Tahlil bosqichiga qarab, biz parametr qiymatlarini, ya'ni berilgan modeldagi jarayonlar tezligi qiymatlarini, r → log10 ehtimollik qiymatlari yig'indisini maksimal darajaga ko'tarish orqali optimallashtirdik: LI ⁢ ( r → ) 1 bosqichda, LI ⁢ ( r → ) + LI ⁢ I ⁢ ( r → ) 2 bosqichda va LI ⁢ ( r → ) + LI ⁢ I ⁢ ( r → ) + LI ⁢ I ⁢ I ⁢ ( r → ) 3-bosqichda. optimal r → turli bosqichlarda farq qilishi mumkin. Biz jurnalning ehtimolligiga qo'shimcha konstantalarni e'tiborsiz qoldirdik, shuning uchun keyingi ma'lumotlar to'plamini moslashtirishga kiritgandan so'ng, oldingi bosqichdagi r → qiymatlari bilan model va qo'shimcha ma'lumotlar to'plami o'rtasidagi mukammal kelishuv bir xil jurnal ehtimoliga olib keladi. avvalgidek qiymat. Barcha bosqichlarda biz MATLAB fmincon funksiyasidan foydalanib, ehtimollikni maksimal darajada oshiradigan r → parametr qiymatlarini topdik.

2-rasmda kiritilgan tezlik parametrlari belgisi bilan biz 3A-rasmdagi misolni olamiz:

Q ⁢ ( r → s ) promotor holati s uchun model tomonidan aniqlangan Markov jarayonining o'tish tezligi matritsasi bo'lsin, bu erda r → s promotor holati s ning tartibga solinadigan parametr qiymat(lar)ini va barcha konstitutsiyaviy parametr qiymatlarini o'z ichiga olgan vektorni bildiradi. . Diagonal bo'lmagan yozuv Q i ⁢ j ⁢ ( r → s ) - i konfiguratsiyadan j konfiguratsiyaga o'tish tezligi va faqat to'g'ri yig'ish, demontaj qilish va siljish reaktsiyalari uchun nolga teng bo'lmagan va keyin r → s yozuvi bilan berilgan. berilgan modeldagi ushbu reaksiyani boshqaradigan jarayonning parametr qiymatini ushlab turadi. Agar siljish reaktsiyalari model ichida hech qanday sirpanish jarayoni bilan boshqarilmasa, ularning tezligi nolga o'rnatiladi. Diagonal yozuvlar Q i ⁢ i ⁢ ( r → s ) = - ∑ j ≠ i Q i ⁢ j ⁢ ( r → s ) bilan beriladi. 3A-rasmdagi misolda faollashtirilgan holatda o'tish tezligi matritsasi (diagonal yozuvlarni ifodalovchi "..." bilan) berilgan.

Q ⁢ ( r → s ) ning p i ⁢ s barqaror holat taqsimoti p j ⁢ s = ∑ i p i ⁢ s ⁢ Q i ⁢ j ⁢ ( r → s ) = 0 ning yechimidir.

Keyin L I ⁢ ( r → ) ni multinomial taqsimot yordamida hisoblash mumkin,

n i ⁢ s bilan mos keladigan promouter konfiguratsiyalarini kuzatishlar soni (1-rasm—manba ma’lumotlari 1).

Har bir model uchun biz mustahkam maksimalni ta'minlash uchun 100 xil boshlang'ich parametr qiymatlari to'plamidan foydalandik. Ruxsat etilgan parametr qiymatlari uchun berilgan modelning barqaror holat taqsimotini hisoblash uchun biz holatni kamaytirish algoritmidan foydalandik (Sheskin, 1985 Grassmann va boshq., 1985 Shanbhag va Rao, 2003). Shu bilan bir qatorda, Matritsa-Daraxt teoremasidan Markov jarayonlarining barqaror holat taqsimotini topish uchun foydalanish mumkin (Vong va Gunawardena, 2020). Biz parametr qiymatlari diapazonini [ 10 - 2 10 2 ] ga cheklab qo'ydik, ulardan biri faollashtirilgan holat uchun global yig'ish jarayonining tezligi qiymati. Kengroq diapazon [ 10 - 3 10 3 ] natijalarga ta'sir qilmadi. Barcha modellarning 3,6 foizida 100 ta urinish kamida ikki xil maksimal ehtimollik qiymatini topdi, ular har doim juda past edi. Barcha modellarning 2,4 foizida topilgan maksimal ehtimollik parametr qiymatlari yagona emas edi. Ikkala holatda ham ushbu muammoli modellarning hech biri nisbatan yuqori maksimal ehtimollikka ega modellar qatoriga kirmagan.

2-bosqichda L I ⁢ ( r → ) va L I ⁢ I ⁢ ( r → ) yig'indisi optimallashtiriladi. Agar eksperimental qatlam o'zgarishlari odatda taqsimlangan bo'lsa, log10 modelning yangi ma'lumotlarni qo'shimcha konstantagacha ko'paytirish ehtimoli quyidagicha ifodalanadi:

fs ⁢ m o'rtacha va fs ⁢ m var mos ravishda o'rtacha va dispersiya bo'lib, s nukleosoma joyidagi yopishqoq N-3 mutant m ning faol holatidagi o'lchangan qulaylik qavatining o'zgarishi (N-2 uchun ikkita va N-3 uchun 3) , fs ⁢ (r →, k → m) mos keladigan model katlama o'zgarishi va k → m - yopishqoq mutant m tezligi prefaktorlarining qiymatlari.

Har bir model uchun fs ⁢ ( r → , k → m ) ni olish uchun biz Q ⁢ ( r → akt ) o‘tish tezligi matritsasining diagonal bo‘lmagan qismidan foydalangan holda har bir mutant uchun o‘zgartirilgan o‘tish tezligi matritsasini hisoblab chiqdik va uni komponentlar bo‘yicha ko‘paytirdik. mutant m (va boshqasi) uchun ta'sirlangan reaktsiyalar uchun k → m prefaktor qiymatlarini o'z ichiga olgan W ⁢ (k → m) matritsasi bilan. O'zgartirilgan o'tish tezligi matritsalaridan foydalanib, biz mutant barqaror holat taqsimotini va nihoyat N-2 va N-3 da kirish imkoniyatlarining mos keladigan katlama nisbatlarini hisoblab chiqdik.

Biz har bir yopishqoq N-3 mutant uchun to'rtta prefaktordan foydalandik, har bir reaksiya guruhi uchun bittadan, N-3 da yig'ish, N-3 da demontaj qilish, N-3 dan N-2 ga va N-2 dan N-3 ga siljish (rasm) 2—rasm qoʻshimchasi 5), mos ravishda k → m = ( k a ⁢ 3 m , k d ⁢ 3 m , k s ⁢ 23 m , k s ⁢ 32 m ) ⊤ ga olib keladi. W ⁢ ( k → m ) diagonaldan tashqari qismi keyin tomonidan beriladi

Bu erda diagonal muhim emas, chunki mutant tezligi o'tish matritsalarining diagonal bo'lmagan qismini olish uchun Q ⁢ ( r → akt ) diagonal bo'lmagan qismi bilan komponentlar bo'yicha ko'paytiriladi. Shunday qilib, L I ⁢ I faqat r → harakatga bog'liq. E'tibor bering, optimallashtirish vaqtida topilgan prefaktorlarning aniq qiymatlari ularning dastlabki holatiga bog'liq edi, chunki ularning eng yaxshi qiymatlari ko'pincha beparvo yoki noyob emas edi, lekin baribir maksimal ehtimollikka olib keldi.

3-bosqichda L I ⁢ I ⁢ I ikkita hissaga ega, har bir histon H3 almashish tajribasi uchun bittadan:

To'g'ri aytganda, L I ⁢ I ⁢ I faqat r → rep ga bog'liq, chunki barcha histon H3 almashinish tajribalari repressiv holatda qilingan. Birinchi hissa uchun, Rufiange va boshq., 2007 ma'lumotlariga mos kelish uchun biz foydalandik

g o'rtacha va g var bilan N-1 da N-2 ga nisbatan o'lchangan log2 nisbatlarining o'rtacha va dispersiyasi mos ravishda (Rufiange va boshq., 2007 yilda Flag-H3 MNase-ChIP, nisbat qiymatlari 0,591 va 0,483) mos ravishda 1 va 2 replikatsiya uchun) va g ⁢ ( r → , t ′ ) modelning tegishli log2 nisbati (Materiallar va usullar bo'limiga qarang: H3 giston almashinuvi modeli) o'lchash vaqti t ′ = 2 soat (uchun tuzatilmagan) kechikish vaqti).

Ikkinchi hissa uchun h j o'rtacha N-1da Myc miqdori bo'yicha Bayroq miqdorining o'lchangan normallashtirilgan o'rtacha log2 nisbatlarini bildirsin, j = 1 , 2 , 3 , 4 to'rt xil vaqt nuqtasini ko'rsatadi. Biz h → o'rtacha = (- 0,417, 1,24, 1,87, 2,60) ⊤ ni Dion va boshq., 2007 dan quyidagicha oldik: ta'riflanganidek (qo'shimcha) o'lchangan o'rtacha log2 Myc/Flag signal nisbati yordamida har bir vaqt nuqtasining normalizatsiya konstantasini qayta hisoblab chiqdik. Dion va boshqalarning materiali, 2007 yil yuqoridagi bo'limda bo'lgani kabi nukleosoma hovuzi parametrlari bilan butun genomli tijorat mikromassivlari (Agilent) ma'lumotlaridan foydalangan holda) va so'ngra probning N-1 pozitsiyasida normallashtirilgan natijalarini oldi. PHO5 promouter (chr2: 431049–431108). Afsuski, qo'shni problar faqat promotor nukleosoma pozitsiyalari orasidagi bog'lovchi hududlarda edi. Dion va boshq., 2007 yilda ta'kidlanganidek va o'z hisob-kitoblarimiz bilan tasdiqlanganidek, h j o'rtacha qiymatlari katta noaniqliklarga ega bo'lib, ular asosan tizimli xatolarga olib keladigan noaniq global normalizatsiya konstantasi tufayli, vaqt nuqtalari orasidagi farqlar oqilona aniqlik bilan aniqlangan. Shunday qilib, biz o'lchangan qiymatlarni faqat mos yozuvlar sifatida to'rtta vaqt nuqtasi bo'yicha o'rtachani tanlab, global normalizatsiya konstantasini yo'q qiladigan transformatsiyadan keyin moslashtirishga qaror qildik: h

j o'rtacha = h j o'rtacha - 1/4 ⁢ ∑ k = 1 4 h k o'rtacha. Let C be the resulting covariance matrix after this linear transformation, assuming an independent estimated experimental standard deviation of 0.4 before the transformation. This estimate was informed by the standard deviation of the Rufiange et al., 2007 data as well as from perturbations of the nucleosome pool parameters when recalculating the normalization constants. The corresponding normalized values of the model are denoted by h

j ⁢ ( r → ) , calculated from the log2 ratios of Flag amount over Myc amount at N-1, h ⁢ ( r → , t j ) (see Materials and methods section: H3 histone exchange model), using the same transformation, with t j denoting the measurement time points. Since the four measurements at different time points were linearly mapped to always have an average of zero, the estimated density follows a degenerate multivariate normal distribution with the covariance matrix C . Thus the log10 likelihood can be calculated with

where C + is the Moore-Penrose inverse (pseudoinverse) of C .

H3 histone exchange model

To obtain the Flag and Myc amounts in a given model with given parameter values and then determine g ⁢ ( r → , t ′ ) and h ⁢ ( r → , t j ) , we used the histone pool and nucleosome turnover models in Dion et al., 2007 and assumed that the Myc H3 and Flag H3 amounts in the histone pool are given by M ( t ) = α M β M and

where we used the production rates α F = 50 / min , α M = 10 / min , the degradation rates β F = 0.01 / min , β M = 0.03 / min and the lag time t 0 = 15 min which were fitted in Dion et al., 2007. For t > t 0 , the probability that a newly assembled nucleosome contains a Flag H3 is given by

In Dion et al., 2007, the conditional probability that a given nucleosome at site l vaqtida t contains a Flag H3 then fulfills the ordinary differential equation

with λ l being an effective turnover rate at probe position l . In our case, the dynamics of the three promoter nucleosomes are coupled, determined by the transition rate matrix Q ⁢ ( r → σ ) of a given regulated on-off-slide model. At this stage, we included different nucleosome types (i.e. Flag and Myc) into the model, replacing the eight promoter configurations by all 27 possibilities to arrange no, a Flag or a Myc nucleosome at each of the three sites. Based on Q ⁢ ( r → σ ) and P + ⁢ ( t | N ) , we define an extended Flag/Myc transition rate matrix E ⁢ ( r → σ , P + ⁢ ( t | N ) ) . Each ‘new’ assembly reaction rate in E ⁢ ( r → σ , P + ⁢ ( t | N ) ) is given by the corresponding ‘old’ assembly rate in Q ⁢ ( r → σ ) times either P + ⁢ ( t | N ) or 1 - P + ⁢ ( t | N ) , for a new Flag or Myc nucleosome, respectively. To find the corresponding ‘old’ reaction any extended Flag/Myc configuration is projected to one of the eight normal nucleosome configurations simply by ignoring the Flag/Myc tag information. For example, denoting Flag- and Myc-tagged nucleosomes with ‘F’ and ‘M’, respectively, an assembly reaction from the state (F, M, 0) to the state (F, M, M) in the extended model corresponds to an assembly reaction from state (1, 1, 0) to the state (1, 1, 1) in the normal model, and its reaction rate is multiplied by 1 - P + ⁢ ( t | N ) in the extended model, since the new nucleosome is Myc-tagged. The rates of sliding and disassembly of Flag or Myc nucleosomes are assumed to be equal to the corresponding normal sliding and disassembly rates. The probability of extended configuration i at time t is the i -th entry of q → * ⁢ ( t ) , the solution of

where σ is fixed in the repressed state, in which all histone exchange experiments took place. The log2 ratios of Flag at N-1 over Flag at N-2 amount, g ⁢ ( r → , t ) , and Flag over Myc amounts at N-1, h ⁢ ( r → , t ) , of each model then correspond to log2 ratios of sums of q i * ⁢ ( t ) over suitable configurations i with Flag or Myc nucleosomes at the wanted sites.

Sensitivity analysis

In order to determine how sloppy the found best parameter values for a given model are, we performed a simple sensitivity analysis, by calculating the log10 likelihood L I + L I ⁢ I + L I ⁢ I ⁢ I along certain directions from the best fit point in logarithmic parameter space. We found that an approximation of the real likelihood function by a second-order Taylor expansion at the best fit point worked only in a small area, as expected in a highly non-linear setting, but too small to determine parameter sloppiness properly.

As a compromise between properly scanning the parameter space and computational feasibility, we chose a small number of test directions: each fitted parameter value individually, the eigenvectors of the numerical Hessian of the likelihood function at the best fit, as well as the numerical gradient, which can be non-zero if the best fit point lies on the boundary. We ignored the boundary during the sensitivity analysis, to also take into account sloppiness that 'reaches over’ the boundary. Along these directions, we tested in exponentially increasing steps from the best fit position which positions in parameter space lead to a decrease of the likelihood by ≈ 50 % , that is, a log10 likelihood ratio change of ≈ 0.30 , which is of similar order as the log10 likelihood differences within our group of satisfactory models. We then obtained 'error bars’ for each parameter by taking the largest deviation of the log10 parameter value at the 50% likelihood level from the best value found in all tested directions (Figure 4—source data 1 and Figure 4—source data 2).

Effective chromatin opening and closing rates

The effective trajectory in time of the regulated process rate from the value of the repressed state to the value of the activated state depends on how fast the cell senses the phosphate starvation and subsequent signal processes. To obtain a reasonable upper bound for the chromatin opening rate, we assumed the regulation happens instantaneously, that is, the activated rate value of the regulated processes applies immediately at the change of the medium for a population in repressed state. Then the promoter configuration distribution decays exponentially toward the activated steady state with a rate well approximated by the negative eigenvalue of the transition rate matrix closest (but not equal) to zero, taking into account the fitted time scale. This ‘effective chromatin opening rate’ is an upper bound of how fast a given model can switch to the activated state. Conversely, we did the same calculations for the ‘effective chromatin closing rate’, which is an upper bound of how fast a given model can switch to the repressed state.

Sticky N-3 experiments

Strains 'sticky N-3 mutant 1’ and 'sticky N-3 mutant 2’ used for restriction enzyme accessibility assays were generated by transformation of linear fragments of plasmids ECS53 and ECS56, respectively, into the wild type strain BY4741 as described for the 'periodicity mutants’ in Small et al., 2014. For the sticky N-3 mutant 1, the sequence GTTTTCTCATGTAAGCGGACGTCGTC inside the PHO5 promoter was replaced with GTTTTCTTATGTAAGCTTACGTCGTC . For sticky N-3 mutant 2, GCGCAAATATGTCAACGTATTTGGAAG was replaced with GCGCAAATATGTCAAAGTATTTGGAAG . Strains were grown in YPDA medium to logarithmic phase for repressive (+Pi) and shifted from logarithmic phase to phosphate-free YNB medium (Formedia) over night for inducing (-Pi) conditions. Nuclei preparation, restriction enzyme digestion, DNA purification, secondary digest, agarose gel electrophoresis, Southern blotting, hybridization, and Phosphorimager analysis were as in Musladin et al., 2014. Secondary digest was with HaeIII for both ClaI and HhaI digests probing N-2 or N-3, respectively. The probe for both ClaI and HhaI digests corresponded to the ApaI-BamHI restriction fragment upstream of N-3.


Videoni tomosha qiling: Абдулазиз ДомлаМадинадаги ХурмозорAbdulaziz DomlaMadinadagi Hurmozor (Avgust 2022).